Poster: GreatBay_SCIE

GreatBay_SCIE: ShroomSweeper

GreatBay_SCIE - a GREAT team. The team is from Shenzhen College of International Education (SCIE), and worked as hard as they can since then, from interpreting past iGEM projects, reviewing the literature, fitting in a small conference room, to working out the mathematic modeling and human practice ideas, wetlab-bing with their utmost care.

Team members: Katherine Wang, Winnie He, Adonie Dong, Ginny Fan, Chloe Ou, Max Chen, Alex Wang, Roger Wang, Jacky Xu, Regina Ru, Evangeline Liu, Jerry Xie, Lambert Wang, Mandy Liang, and Alice Zhen.
Team PI: Dr. Yeqing Zong
Team Instructor: Dr. Yiming Dong
Advisors: Diana Tan, Uranium Chen, Alexis Zeng, Harry Jiang

Our project, ShroomSweeper, improves the current methods of mushroom poison detection by improving antibodies and our improved detection assay, ALFA - Aptamer Lateral Flow Assay, "sweeps" the minefield of mushrooms for the mushroom pickers. We aim to make an easy, cheap, rapid and portable mushroom toxin detector.

Inspiration

Mushrooms are a delicacy in many areas around the world. In Yunnan province, China, mushroom collection and selling are the ways of earning a living for many families. Wild mushroom markets are full of mushrooms collected from mountains by individuals, and it is a tradition for Yunnan people to buy mushrooms for their families. However, in many occasions, the joy of palatable dishes comes at a cost of lives - mushroom collectors would pick up and sell poisonous mushrooms by accident, due to the lack of a method to verify if the mushroom is poisonous or not. Even doctors cannot identify which kind of mushrooms has caused the poison because of the lack of device to detect toxin in the hospital, so the proper treatment targeting at specific toxin is sometimes delayed, endangering patients’ life. There is not a single way in the field that could provide a convenient way to detect mushroom toxins.We want to make a change to this current situation.

Before we started to design our product, we investigated the current methods of mushroom toxin detection and our stakeholders' expectations of our product through interviews, questionnaires and a visit to the Guangdong Institute of Microbiology.

LCMS, a current method to detect amanitin. It is expensive, unportable and difficult to operate.

The feedback we got from our stakeholders.

Also, the researchers from the Guangdong Institute of Microbiology suggested that we start from detecting a common mushroom toxin - amatoxin, which has lead to 90% of all mushroom poisoning death cases.

Combining all these opinions and suggestions from stakeholders, we decided to develop a rapid, easy, portable device for mushroom collectors, researchers and doctors to detect poisonous mushrooms, as well as the type of toxin they contain.

scFv

As one of the current methods for detecting amatoxins requires antibodies, and which has many limitations and disadvantages, we decided to first improve the antibodies used. scFv (single-chain fragment variable) is the variable fragment of an antibody connected by a linker, having the same or higher affinity towards antigens, and can be produced in bacteria instead of mammal cells or mammals.

Fig.1 The sketch map shows the basic structure of scFv.

scFv has a better binding affinity, higher stability, and lower cost as well as many other advantages compare with the traditional antibodies. We discovered an existing anti ɑ-amanitin scFv, which we have used as our detection molecule. And we have constructed a series of expression vectors to express the scFv in E.coli BL21(DE3).

Fig.2 The plasmid map of scFv expression vector.

We have optimized the production of scFv by linking a pelB tag to allow secretion to the periplasm, and used arginine extraction method to extract scFv. We also improved the culture conditions for scFv.

Fig.3 The SDS-PAGE shows different results of scFv expression in BL21(DE3) after arginine extraction.

We have tested the function of scFv by ic-ELISA(indirect competitive ELISA). The results showed that the scFv has a relatively low IC50(13.27ng/ml), meaning it has high affinity and sensitivity towards α-amanitin and has potential to test the presence of toxins in various kinds of samples, thus further developments like ELISA kit and colloidal gold test strips could be done to our scFv.

Fig.4 The result we collected from ic-ELISA, and we calculated the IC 50 of the scFv.

However, protein production in E.coli is not that cost-efficient and scFv still has some limitations; ic-ELISA and regular ELISA are both very time-consuming and requires laboratory apparatus, which are not what our project finally aims for. We need a better ligand, and a better method. Please click on our "Aptamer" part.

Aptamer

Here is our solution - aptamers. They are oligonucleotides with special structures that can bind with certain molecules, including amanitin. They have better thermo stability and chemical stability, and can can be selected through a process called SELEX. Once the sequence is obtained, it can be produced in a large-scale, unlike antibodies. Aptamers have all the functions of an antibody, and they are way better in multiple aspects!

To make use of aptamers, we first verified the binding affinity of aptamers for α-amanitin from previous literatures, which we used for our hardware demonstration.

Fig.1 Structure of the aptamer that we found in previous literature

Fig.2 Result of testing the affinity of Best1 aptamer against α-amanitin.

We then selected and chosen 2 aptamers by ourselves for β-amanitin(which aptamer selection has never been achieved before in the academic field) from random DNA pools through 15 cycles of SELEX. Firstly, a random pool of ssDNA is generated, with a fixed 'head' and 'tail', for primer to bind in amplification. The pool is incubated with the toxin and those who could specifically bind to β-amanitin are retained, amplified, and used as the pool for the next round.

Fig.3 The SELEX Procedure

Theoretically, we could replicate the exact chemical method mentioned in the literature, immobilizing the toxin on carboxylic magnetic beads. However, due to β-amanitin's cyclopeptide strucutre, it lacks an important functional group to be conjugated to carboxylic magnetic beads. Thus, we conjugated the amanitin to BSA, a larger protein, which can be conjugated onto the magnetic beads.

Fig.4 The spectrum used to verify the conjugaton of amanitin and BSA

We then managed to do the SELEX, but the aptamer sequences are too short for sequencing, so we insert them into PSB1C3 plasmids and then into E.coli. The sequences are then synthesized and tested on their binding specificity and affinity through ELONA(An experiment to confirm the binding affinity and specificity of aptamers), and among those sequences, two of them were proved to be good aptamers. Here are their sequences and our result:

Apt1: 5'- CATGCTTCCCCAGGGAGATGTAGCGTCTGAAGCCGTTT
CATGCATTGCTACAACCCATGAGAGGAACATGCGTCGCAAAC -3'

Apt2: 5'- CATGCTTCCCCAGGGAGATGGCCCGGGGTAACGTAGCC
AGATTAGGTCGTGATCGTGATGGAGGAACATGCGTCGCAAAC -3'

Fig.5 The ELONA of our Apt1 and Apt2 toward β-amanitin.

Finally, we improved the limit of detection(LOD), guided by our model, of aptamers in order to further use them in our hardware. For our final product to be portable and rapid, we integrate the Lateral Flow ImmunoAssay using aptamers instead of antibodies, and we worked out a new design - ALFA, aptamer lateral flow assay. You can see the results in our hardware section.

Model

We constructed 2 models that guided our project design and experiments.

The first model aims to determine the dissociation constant between amatoxin and its aptamer obtained from previous literature, as well as use this constant to determine the best aptamer concentration for competitive test on the test strip. We attempt to use the basic electrophoresis approach to determine the dissociation constant, in which the fluorescence of DNA bands could quantify the concentration of aptamer-target complex and free aptamer respectively.

Fig.1 Fitting curve for determining dissociation constant by varying aptamer concentration

Based on thermodynamic equations and our experimental results the final dissociation constant is determined to be 25.2 μM.

Then, this value is used for the competitive test between immobilized toxin and free toxin, in which the aptamer concentration is covariate of total percentage of bound aptamer. At lower aptamer concentrationm, the dynamic range is more narrow so that it's more sensitive to toxin and allows a lower LOD.

Fig.2

The other model we created aims to aid the design of the ALFA test strip: we wish to arrive at a relationship between the given parameters (such as toxin concentration, aptamer concentration, membrane diffusion velocity, sample volume, etc.) and the distance between the start of the test strip and the test line in order to leave enough time and distance for the initial reaction mixture to descend into equilibrium to a certain extent so the amount of excess aptamers could be assessed and reported using colloidal Gold.

A diffusion-convection-reaction partial differential equation was constructed with an initial condition and two boundary conditions. Upon solving with a set of hypothetical values for the parameters of the model, we obtained the following 3D plot for the concentration of the aptamer-toxin in sample conjugate at given positions on the test strip at different times:

Fig.3

Taking the concentration-distance graphs at several different times (t=150,300,450,600), we obtain the following graph:

Fig.4

We observe that at each time, the conjugate concentration increases with increasing distance, but approaches a maximum value. And this maximum value increases with increasing time.

We arrive at the conclusion that there exists an optimal test line position, where the aptamer-toxin equilibrium has completed to a certain extent, and the time is minimized to reduce the test time. We refer back to this conclusion when we are designing our test strip hardware, where an appropriate amount of space will be left between the starting position and the test line.

Hardware

From previous questionnaire with stakeholder(mushroomer) as mentioned above, we acknowledged that they prefer a low price, rapid detection and above all, a portable device.

To meet the requirements of our stakeholders, we aim to develop hardware for amatoxin detection that meets their demands. Our original design is inspired by the traditional construction of LFIA (Lateral Flow ImmunoAssay), called ALFA(aptamer lateral flow assay). Different from the sandwich assay used in pregnancy test kit, we selected a competitive test principle since amatoxin is small in size for enough binding sites at upper and lower surface.

However, after contacting doctor Ying Yang, who deals with mushroom poisoning, we innovated another construction, incorporating a signal amplification method to amplify aptamer to lower the limit of detection as she suggested. Among all, we selected RPA(Recombinase Polymerase Amplification) for it can work under an isothermal environment. Through this methodology, we detect amplicon of toxin bound aptamer on test line instead. The limit of detection is also improved through competitive test, shown in the graph below.

Fig.1

As we can see, after addition of excess free toxin in lane 2 and lane 4, the fluorescence decreases significantly, indicating a lower proportion of bound aptamer. This concept is feasible for both concentration of stock solution(lane2-3) and 100 times dilute solution(lane3-4)

Fig.2

Furthermore, we interviewed Doctor Deng from Guangdong Institute of Microbiology, who suggested us to aim for facilitating the use of hardware. Therefore, we adopted her suggestions and utilized microfluidic sliding chip methodology which is compatible with our lateral flow design, without significant change in our designing initiatives.

We also create a manual in 4 languages to demonstrate the operation of hardware in wild circumstances as well as in clinical situation.

Our prototype of toolbox is tested by volunteer trial testers, who commented highly on our design. In the foreseeable future, we aim to industrialize our product and further decrease price, ensuring its popularity among our stakeholders.

In conclusion, we succeeded in designing an easy-to-operate, rapid (detection time within minutes), cheap (less than $15, much cheaper than current devices) and portable(small test strip) mushroom toxin detector. In the foreseeable future, we aim to industrialize our product and further decrease price, ensuring its popularity among our stakeholders.

Fig.3

Fig.4

Human Practice

Human Practices are an important part of the whole project, in which we interviewed and gained valuable opinions from our stakeholders, such as mushroom collectors and doctors. Through in-depth communications and establishing two-way dialogues with the potential users of our device, we managed to improve our project design and hardware design according to their suggestions. We designed several questionnaires for our stakeholders to investigate their expectations about our product.

Fig.2

Moreover, we designed a questionnaire for the general public to express their opinions on Synthetic Biology and our project. The results from our questionnaire to the general public showed that they have many misunderstandings and questions on Synthetic Biology. Therefore, we decided to host a range of activities as Education and Public Engagement. A TEDx talk and a workshop was held by us in our school in which we spread knowledge on SynBio and ethics to our peers and teachers.

Fig.1

In addition, we contacted professionals and experts in different fields and they provided us with useful suggestions throughout the project to help us improve. We also attended the Conference of China iGEMer Community and presented our project to the other attendees and judges, in which we won the two awards - Best Presentation and Best Poster as the only high school team among the winners.

Fig.3

An extracurricular club - SCIE iGEM was established,where SynBio and iGEM related knowledge are taught to the members. Some of the members joined us to a lab tour held by us, in which we taught basic experiments operations. We went to Shenzhen Youth Activity Centre, to introduce SynBio theory and practical to primary school children. Last but not least, we wrote passages and made videos about our project and synthetic biology and posted them on social media platforms to attract more people.

Acknowledgements

Thanks to the many experts and professionals who kindly offered us help throughout our project:

Dr. Candace Bever provided us with suggestions about how to deal with amatoxins safely and helped us contact Professor Yanru Wang to create amanitin-BSA conjugates for our experiment.

Dr. Ciara O'Sullivan and Dr. Miriam Jauset-Rubio gave us precious suggestion on experiments, hardware design and models.

Dr. Wojciech Strzałka suggested that it will be worthy for us to select proper aptamers for beta-amanitin since most of the recent researches are based on alpha-amanitin.

Dr. Qinqin Han provided suggestions that helped us to improve our experimental method used in ELONA and Dot blot.

iGEM Team EPFL 2019 provided us with useful suggestions on the method of Recombinase Polymerase Amplification, hardware design and human practice activities.

Dr. Ying Yang from Shenzhen Hospital of Peking University provided detailed explanation of the current situation on treating the mushroom-poisoned patients.

Professor Wangqiu Deng offered us a visit to the Guangdong Institute of Microbiology, and provided suggestions for our hardware design as well as the organization of a trip to Baiyun Mountain for us to gain better understanding of the current situation.

Thanks to the mushroom collectors who was willing to chat with us, and filling out our questionnaires.

Thanks to all people who filled out our questionnaires on SynBio and mushroom poisoning.

Thanks to the sponsors and teachers in Shenzhen Bluepha Lab for guiding us through our project and providing laboratory for us to work in.

Reference:

Ahmad ZA, Yeap SK, Ali AM, Ho WY, Alitheen NBM, Hamid M. “ScFv antibody: Principles and clinical application”. Clin Dev Immunol.
Kiprijanov, Sergej. “Bacterial Expression, Purification, and Characterization of Single-Chain Antibodies”.
He K, Mao Q, Zang X, Zhang Y, Li H, Zhang D. “Production of a broad-specificity monoclonal antibody and application as a receptor to detection amatoxins in mushroom”. Biologicals.
Zhang X, He K, Zhao R, Feng T, Wei D. “Development of a Single Chain Variable Fragment Antibody and Application as Amatoxin Recognition Molecule in Surface Plasmon Resonance Sensors”. Food Anal Methods.
Jauset-Rubio M, Svobodová M, Mairal T, et al. “Aptamer Lateral Flow Assays for Ultrasensitive Detection of β-Conglutin Combining Recombinase Polymerase Amplification and Tailed Primers”. Anal Chem.
Lobato IM, O’Sullivan CK. “Recombinase polymerase amplification: Basics, applications and recent advances”. TrAC - Trends Anal Chem.
Li JJ, Fang X, Tan W. “Molecular aptamer beacons for real-time protein recognition”. Biochem Biophys Res Commun.
Chen A, Yang S. “Replacing antibodies with aptamers in lateral flow immunoassay”. Biosens Bioelectron.
Han Q, Xia X, Jing L, et al. “Selection and characterization of DNA aptamer specially targeting α-amanitin in wild mushrooms”. SDRP J Food Sci Technol.
Hidding J. “A therapeutic battle: Antibodies vs. Aptamers”. Nanosci master Progr.
Hu T, Wessels H, Fischer C, et al. “Aptamers Using Magnetic Separation and BEAMing”. Anal Chem.
Muszyńska K, Ostrowska D, Bartnicki F, et al. “Selection and analysis of a DNA aptamer binding α-amanitin from Amanita pphalloides”. Acta Biochim Pol.
Qian, S., & Bau, H. H. “A mathematical model of lateral flow bioreactions applied to sandwich assays”. Analytical Biochemistry.
Ragavendar, M. S., & Anmol, C. M. “A mathematical model to predict the optimal test line location and sample volume for lateral flow immunoassays”. Annual International Conference of the IEEE Engineering in Medicine and Biology Society, 2012.
Hoare, Sam R.J. “Receptor binding kinetics equations: Derivation using the Laplace transform method”. Journal of Pharmacological and Toxicological Methods.
Levine HA, Nilsen-Hamilton M. “A mathematical analysis of SELEX”. Comput Biol Chem. Koussa MA, Halvorsen K, Ward A, Wong WP. “DNA nanoswitches: a quantitative platform for gel-based biomolecular interaction analysis”. Nat Methods.
Koussa MA, Halvorsen K, Ward A, Wong WP. “DNA nanoswitches: a quantitative platform for gel-based biomolecular interaction analysis”. Nat Methods.
Thevendran R, Navien TN, Meng X, Wen K, Lin Q, Sarah S, Tang TH, Citartan M. ”Mathematical approaches in estimating aptamer-target binding affinity”. Anal Biochem.
Bever CS, Hnasko RM, Cheng LW, Stanker LH. “A rapid extraction method combined with a monoclonal antibody-based immunoassay for the detection of amatoxins”. Toxins (Basel).
Bever CS, Swanson KD, Hamelin EI, et al. “Rapid, sensitive, and accurate point-of-care detection of lethal amatoxins in urine”. Toxins (Basel).
Chen, Y., Yip, L., Corriden, R., Insel, P. A., & Junger, W. G. “Cell surface expression of A3 and A2A adenosine receptors defines the response of PMN to hypertonic saline”. Shock, 26(Supplement 1), 29.
Yu Q, Zhao Q, Wang S, et al. “Development of a lateral flow aptamer assay strip for facile identification of theranostic exosomes isolated from human lung carcinoma cells”. Anal Biochem.
Narongchai S, Narongchai P. “Deactivation Study of α-Amanitin Toxicity in Poisonous Amanita spp. Mushrooms by the Common Substances In Vitro”. J Forensic Res.

Team:GreatBay SCIE/Poster

Poster: GreatBay_SCIE