Team:TUDelft/Experiments

PHOCUS

Experimental details

General

Primers
Agar plate
  1. Dissolve 14.24 g of LB-agar in 400 mL of milli-Q.
  2. Autoclave the LB-agar solution.
  3. Cool the agar down to room temperature. To facilitate the process, you can hold the bottle under the cold water tap.
  4. Add the correct amount of the correct antibiotic. For example, for our antibiotic stock solutions we used 1 µL of antibiotic solution/mL of LB-agar.
  5. Under sterile conditions, pour the LB-agar in empty Petri dishes.
  6. Leave the Petri dishes near the flame with the lid partially off for approximately 5 minutes so the agar can solidify.
Antibiotic stock solution

For 1000X antibiotic stock solution:

  1. Weigh X grams of the specific antibiotic of interest.
  2. Resolve in 95% ethanol (Chloramphenicol) or MilliQ (other antibiotics)
Glycerol stocks

Bacterial stock with glycerol

  1. Incubate ~50 µl cells in 5 ml LB and selection marker overnight
  2. Pipette 1,5 ml in eppendorf and spin down the bacterial culture
  3. Repeat step 2 till enough pellet has been formed (about 3ml of bacterial culture)
  4. Resuspend the pellet in 0.9 ml liquid bacterial culture
  5. Add the liquid bacterial culture from eppendorf to cryotube
  6. Add 0.9 ml 50% glycerol to the cryo tube and mix well
  7. Store at -80°C
Liquid medium

LB medium preparation

  1. Dissolve Luria Broth powder in water according to instructions by the manufacturer.
  2. Heat sterilize (121 °C) the medium in the autoclave.
  3. After cooling down, add the required antibiotic in sterile conditions.
    4. NOTE: With our antibiotic stock solutions of 1000x we used 1µL of antibiotic solution per mL of LB-agar.
  4. Store the medium at 4 °C if complemented with antibiotics.
Liquid starter culture
  1. Label as many 15mL Falcon tubes and mark well: date, content of tube including organism and insert, name.
  2. In sterile conditions from now on, pipette 5ml - 10mL of liquid medium (LB or SOC) for each starter culture.
    3. NOTE: Supply with relevant antibiotics.
  3. Pick a colony with the inoculation loop and swirl it in the starter culture to inoculate.
  4. Grow the liquid cultures at 37 °C overnight, shaking at 250rpm.)
Making electrocompetent cells
  1. Thaw your cells on ice
  2. Streak the cells on a plate with the corresponding antibiotics and let it grow overnight at 37 °C
  3. Inoculate 30 mL LB with picked colonies from the plate in a 50 mL Greiner tube.
  4. Grow till an OD of ~0.5
  5. Centrifuge for 10 minutes at 4 °C at 3900 rpm.
  6. Discard the supernatant and dissolve pellet in 20 mL cold milli-Q.
    7. NOTE: make sure all the cells are resuspended!
  7. Centrifuge for 10 minutes at 4 °C at 3900 rpm.
  8. Discard the supernatant and dissolve pellet in 20 mL cold milli-Q.
  9. Centrifuge for 10 minutes at 4 °C at 3900 rpm.
  10. Discard supernatant and resuspend in 200 µL glycerol
  11. Prepare aliquots of 50 µL
  12. Either transform straight away or store at -80 °C
Primer working stock

Based on protocol given by Integrated DNA Technologies (IDT).

  1. Centrifuge the tube containing the primer for 3−5 seconds (>3,000 x g) to pellet the material to the bottom of the tube.
  2. Dissolve the DNA material in sterile MilliQ according to the supplier IDT. This creates a 100µM stock solution.
  3. Heat the primer stock solution to 65 °C for 20 minutes.
  4. Centrifuge the primer stock solution at maximum speed (~17,000 x g) for 2 minutes.
  5. Prepare a 10X diluted work solution (10µM) by dilution with sterile MilliQ.
  6. Store both Stock and Work solutions at -20 °C.
Sequencing samples
  1. Prepare sample in 1.5mL tube; mix DNA template and primer: 5μL template + 5μL primer in each tube or well. Concentrations of sample vary depending on type of sample. See table:

  2. Sample type Concentration [ng/µl] Minimum volume [µl]
    Plasmid 100 5
    Purified PCR product <300bp → 10-15, 300-700bp → 25-50, >700bp → 50 5
    Primer 60 5
  3. Label (EZ-seq label)
  4. Submit sample

DNA

DNA concentration determination

Using NanoDrop UV-VIS Spectrophotometer.

  1. Press the button for dsDNA to measure the concentration of double-stranded DNA in your samples.
  2. Clean the measurement surface with a piece of tissue and ethanol.
  3. Use 1-1.5 µL of sterile milli-Q as a blank.
  4. Clean the measurement surface with a piece of tissue and water.
  5. Use 1-1.5 µL of sample to measure its concentration.
    6. NOTE: It is best to measure the same sample in triplo and use the average value.
  6. If you have multiple samples, clean the measurement surface in between measurements.
DNA electrophoresis
  1. Prepare TAE buffer: take the 10X concentrated TAE from the chemicals cabinet and dilute it 10 times with milli-Q. For 500 mL, add 50 mL to 450 mL of dH2O.
  2. Weigh agarose for a 1% gel. For 200 mL, 2 g of agarose is necessary.
  3. Mix the TAE solution with the agarose and heat the solution (in a microwave) until it is completely dissolved.
  4. Add SYBR Safe to the gel mould. For a small gel (40 mL of the prepared TAE/agarose mixture) add 4 µL of SYBR Safe; for a large gel (100 mL) add 10 µL of SYBR Safe.
  5. Pour the solution into the mould, making sure there are no bubbles and that the SYBR Safe is completely mixed. Add a comb to create wells for the samples. Let it solidify (approx. 20 minutes).
  6. Transfer the gel to the electrophoresis cell minding the arrow that indicates the direction of DNA migration. Remove the combs and cover it with TAE.
  7. Prepare the electrophoresis samples (on parafilm); 1 µL of Nucleic Acid Loading Buffer per 5 µL of sample.
  8. Load the molecular weight marker (ladder) in the first well (check the appropriate volume for each marker, generally 5 µL works fine) and load 5-10 µL of the samples in the other wells, according to the order in your lab journal.
    9. NOTE: Do not contaminate the loading buffer and ladder with SYBR Safe! Do not touch it while wearing a glove.
  9. Connect the cables following the colour code and run at 100-130 V for 30-60 min.
DNA gel purification & PCR cleanup (Promega Wizard kit)
  1. Excise DNA band from gel and place gel slice in a 1.5ml microcentrifuge.
  2. Add 10μl Membrane Binding Solution per 10mg of gel slice. Vortex and
  3. Incubate at 50–65°C until the gel slice is completely dissolved.
  4. Insert SV Minicolumn into Collection Tube.
  5. Transfer dissolved gel mixture or prepared PCR product to the Minicolumn
  6. assembly. Incubate at room temperature for 1 minute.
  7. Centrifuge at 16,000 × g for 1 minute. Discard flowthrough and reinsert Minicolumn into Collection Tube.
  8. Add 700μl Membrane Wash Solution (ethanol added). Centrifuge at 16,000 × g for 1 minute. Discard flowthrough and reinsert Minicolumn into Collection Tube.
  9. Repeat Step 9 with 500μl Membrane Wash Solution. Centrifuge at 16,000 × g for 5 minutes.
  10. Empty the Collection Tube and centrifuge the column assembly for 1 minute with the microcentrifuge lid open (or off) to allow evaporation of any residual ethanol.
Genome extraction
Golden Gate assembly
  1. Set up 25 µl assembly reactions as follows:
    Reagent Quantity pGGA Destination plasmid, 75 ng/μL 1μL 24 precloned inserts cloned into pMiniT 2.0, 100ng/μl each 0.75μl each (18μL total) T4 DNA ligase buffer (10X) 2.5 μL T4 DNA ligase, 1000 U/μL 0.5 μL Bsal-HFv2, 20U/μL 1.5 μL Nuclease-free water 1.5 μL
  2. Mix gently by pipetting up and down 4 times.
  3. Briefly microcentrifuge (1 sec.) to bring material to the bottom of tube.
  4. Transfer to thermocycler and program as follows: (5 min 37°C → 5 min 16°C) x 30 cycles followed by 5 min 60°C. If reactions are done overnight, add a 4°C terminal hold to the protocol, but repeat the final 5 min 60°C step the next day before the transformations.
  5. Perform transformation .
Ligation
  1. Thaw the ligase buffer on ice, to prevent damaging the ATP.
  2. Prepare a sample as follows:
    Component Volume (µL)
    10X Ligase buffer 2
    T4 DNA Ligase 1
    DNA vector x (~100ng)
    DNA fragment Y*
    MilliQ Z
    Total 20
  3. Incubate for at least one hour at 4 °C. Optimally, incubate overnight at 4 °C.
NEBuilder HiFi DNA assembly
  1. The following on ice:
    Recomended amounts
    Assembly of 2-3 fragments Assembly of 4-6 fragments
    Vector:insert ratio 1:2 1:1
    Fragments 0.03-0.2pmol (XµL)) 0.2-0.5 pmol (XµL)
    NEBuildier HiFi DNA assembly Master mix 10µL 10µL
    Dionized water 10-X µL 10-X µL
    Total 20µl 20µl
  2. Incubate at 50 degrees C for 15 minutes for 2-3 segments; one hour for 4-6 fragment
  3. Store at -20 degrees C.
PCR (GoTaq)
  1. Add the following components in a PCR tube:

    2. Component Volume (µl)
    PCR grade water X
    5x Green GoTaq buffer 10
    PCR Nucleotide Mix, 10mM each 1
    1µM Primer FW 1
    1µM Primer RV 1.5
    GoTaq DNA Polymerase (5.0 U/µL) 0.25
    TemplateDNA (<0.5µg/50µl) Y
    Total 50

  2. Perform PCR with thermocycle:

    3. Step Temperature (°C) Time #cycles
    Initial denaturation 95 2 minutes 1
    Denaturation 95 30 sec 25-35
    Annealing 42-65 (based on Tm) 30 sec
    Extension 72 1 minute/kb
    Final extension 72 5 1
    Hold 12 ∞
PCR (KOD Xtreme™)
  1. Add the following components for a KOD Xtreme™ PCR in a PCR tube:

    2. Component Volume (µl)
    PCR grade water X
    2x KOD Xtreme™ PCR Buffer 25
    2 mM dNTPs 10
    10pmol/µL Primer FW 1.5
    10pmol/µL Primer RV 1.5
    KOD Xtreme™ Hot Start DNA Polymerase (1.0 U/µL) 1
    Genomic DNA (200ng) Y
    Plasmid DNA (50 ng) Z
    Total 50

  2. Perform PCR with three-step thermocycle:

Step Temperature (°C) Time
Initial denaturation 94 2 minutes
Denaturation 98 10 sec
Annealing Tm minus 5 30 sec
Extension 68 1 minute/kb
Hold 12 ∞
PCR (Q5 High-fidelity 2x)
  1. Add the following components in a PCR tube:

    2. Component Volume (µl)
    PCR grade water X
    Q5 High-Fidelity 2x Master Mix 25
    10µM Primer FW 2.5
    10µM Primer RV 2.5
    TemplateDNA (< 1,000ng) Y
    Total 50

  2. Perform PCR with thermocycle:
  3. Perform PCR with three-step thermocycle:

Step Temperature (°C) Time #cycles
Initial denaturation 98 30 seconds 5-10 seconds
Denaturation 98 5-10 sec 25-35
Annealing 50-72 (based on Tm) 10-30 sec
Extension 72 20-30 seconds/kb
Final Extension 72 2 minutes 1
Hold 12 ∞
PCR&DNA clean-up (NEB Monarch)
  1. Dilute sample with DNA Cleanup Binding Buffer according to the table below. Mix well by pipetting up and down or flicking the tube. Do not vortex.

    2. Sample type Ratio of binding; buffer:sample
    dsDNA < 2 kb (plasmids, gDNA) 2:1
    dsDNA &st; 2 kb (some amplicons, fragments) 5:1
    ssDNA* < 200 nt 7:1
  2. Insert column into collection tube and load sample onto column.
  3. Spin for 1 minute, then discard flow-through.
  4. Re-insert column into collection tube. Add 200 μl DNA Wash Buffer and spin for 1 minute. Discarding flow-through is optional.
  5. Repeat step 4.
  6. Transfer column to a clean 1.5 ml microfuge tube.
  7. Add ≥ 6 μl of DNA Elution Buffer to the center of the matrix.
  8. Wait for 1 minute, then spin for 1 minute to elute DNA.
  9. Label tube and store at -20 degrees C
Plasmid DNA isolation (Promega PureYield)

Prepare Lysate

  1. Transfer 1.5mL of bacterial culture to sterile 1.5 ml microcentrifuge tube(s). Centrifuge at max speed for 5 minutes. Discard supernatant.
  2. Add additional 1.5mL and repeat step 1.
  3. Add 600µL sterile water to the pellet and resuspend.
  4. Add 100 µL of Cell Lysis Buffer (blue), and mix by inverting the tube 6 times.
  5. Add 350 µl of cold (4–8 °C) Neutralization Solution, and mix thoroughly by inverting.
  6. Centrifuge at maximum speed in a microcentrifuge for 3 minutes.
  7. Transfer the supernatant (~900 µl) to a PureYield™ Minicolumn without disturbing the cell debris pellet.
  8. Place the minicolumn into a Collection Tube, and centrifuge at maximum speed in a microcentrifuge for 15 seconds.
  9. Discard the flowthrough, and place the minicolumn into the same Collection Tube.

    10. Wash

  10. Add 200 µl of Endotoxin Removal Wash (ERB) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 15 seconds
  11. Add 400 µl of Column Wash Solution (CWC) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 30 seconds.

    12. Elute

  12. Transfer the minicolumn to a clean 1.5 ml microcentrifuge tube, then add 30 µl of sterile milli-Q directly to the minicolumn matrix. Let stand for 1 minute at room temperature.
  13. Centrifuge for 15 seconds to elute the plasmid DNA.
  14. Determine plasmid DNA concentration. Store at -20 °C.
Restriction
  1. Decide on which restriction enzyme(s) to cut with. Check online (NEB) what buffer the enzyme(s) work(s) in . For most of the restriction enzymes, the CutSmart buffer 10X can be used.
  2. Prepare a 20µL sample as follows:

    3. Component Volume (µL)
    10X CutSmart buffer (NEB) 2
    Fragment (~1-2μg) X
    Restriction Enzyme(s) 1 (per enzyme)
    MilliQ Y
    Total 20
  3. Incubate for 4 hours at 37 °C.
  4. Inactivate the restriction enzyme(s) by heating to 65 °C for 10 minutes.
Transformation of chemically competent cells
  1. Aliquot competent cells into 50 µL. Thaw on ice for 10-15 min.
  2. Add 1-100ng plasmid DNA (1-5µL) to the 50 µL of competent cells. Mix by flicking the tube 4-5 times. Incubate on ice for 30 minutes.
  3. Heat shock at 42 °C for exactly 10 seconds. Then place on ice for 5 minutes.
  4. Add 350µL of fresh, warmed (approx. 37 °C) LB or SOC-medium.
  5. Incubate at 37°C with shaking for 1 hour.
  6. Plate 50µL of the cells out on pre-warmed (approx. 37 °C) LB-agar plates with the correct antibiotic to select. Remaining liquid can be plated on another plate.
  7. Incubate at 37 °C overnight. Alternatively, you can incubate over the weekend, leaving the plate on the bench.
Transformation of electrocompetent cells

  1. Thaw 20 ul of electrocompetent cells on ice
  2. Add 1-2 ul of DNA to the cells and incubate on ice +/- 1 min
  3. Transfer the cell-DNA mixture to the ice-cold electroporation cuvette
  4. Put the cuvette in the electroporator and press start (settings: 2500 V).
    5. NOTE: if the lid does not fit, put parafilm instead.
  5. Immediately add 950 ul of SOC medium and pipette up and down
  6. Transfer to an eppendorf tube and incubate for 1-1.5 h at 37ºC 800 rpm.
  7. Plate the cells on LB plates with the required antibiotic:
    • 50 µl of cells
    • Spin down the rest 3 min at max rpm, discard supernatant and plate.
  8. Incubate the plates at 37ºC overnight.

Proteins

HiLink™ Spin Protein Purification System (Promega)

Preparation of FasBreak™ reagent/DNase I solution

  1. Add 80µl of Nuclease-Free Water to the vial of DNase I.
  2. Mix completely to dissolve the powder.
  3. Remove the DNase solution from the vial and add it to 1ml of Nuclease-Free Water. Mix well.
  4. Prepare FasBreak™ reagent/DNase I solution by mixing 5.8µl DNase I solution with 64.2µl FastBreak™ reagent, 10X. This is the quantity for one reaction.

    5. Centrifugation protocol

  5. Pipet 700µl of bacterial culture into a 1.5ml microcentrifuge tube. Add 70µl of the FastBreak™ Reagent/DNase I solution to the culture.
  6. Transfer 75µl of the HisLink™ Resin from the settled resin bed to the 1.5ml microcentrifuge tube (pipet slowly and deep into the settled resin).
  7. Incubate the sample and resin for 30 minutes on a shaking platform.
  8. Place a Spin Column onto a Collection Tube (or a new 1.5ml microcentrifuge tube). Transfer the lysate and resin from the original 1.5ml microcentrifuge tube to the spin column.
  9. Centrifuge the spin column with the collection tube for 5 seconds or until the liquid clears the spin column.
  10. Place the spin column back onto the collection tube. Add 500µl of HisLink™ Binding/Wash Buffer to the spin column, then cap the spin column. Centrifuge for 5 seconds or until the Binding/Wash Buffer clears the spin column. Discard the flowthrough. Repeat for a total of two washes.
  11. Take the spin column off the collection tube and wipe the base of the spin column with a clean absorbent paper towel to remove any excess HisLink™ Binding/Wash Buffer.
  12. Place the spin column onto a new 1.5ml microcentrifuge tube. Add 200µl of HisLink™ Elution Buffer. Cap the spin column and tap or flick it several times to resuspend the resin. Wait 3 minutes.
  13. Centrifuge the spin column and microcentrifuge tube at 14,000rpm for 1 minute to collect the eluted protein.
Protein expression

All work was performed within a sterile field created by a bunsen burner flame.

  1. Grow culture containing (plasmid) DNA coding for protein of interest as described in liquid starter culture protocol.
  2. Measure the OD600 to confirm growth
  3. Refresh starter culture in 150mL LB with required antibiotics and let the culture grow until an OD600 of 0.4-0.6. Induce protein expression by adding IPTG.
  4. Grow the cells for 16 hours or 18 °C and 180rpm rotation. Sample every hour if needed - check OD600 standardize sample to OD600 of 1.
  5. Harvest the liquid culture by centrifugation at max speed for 15 minutes.
  6. Store pellet in -20°C
SDS-PAGE precast gels
  1. Add 5 µL sample buffer (SDS) to 20 µL protein sample.
  2. Heat at 95 °C for 10 min.
  3. Load 5µL boiled sample to precast gel in electrophoresis cassette. Gel is covered in TAE buffer.
  4. Run Gel at 150 V for 50 min
  5. Remove gel from plastic casing, wash with milliQ. Repeat wash process.
  6. Pour coomassie stain over the gel and leave gel shaking for 10 min.
  7. Discard stain, cover gel in demi-water and leave to destain for a couple of hours.
Western blot

Prepare buffers for Western Blotting:

  1. Transfer buffer (keep at room temperature) with end concentrations of:
    • 25mM Tris base
    • 102mM glycine
    • 20%methanol
    • 0.05% SDS
  2. 1x TBS-T
    • 10mM Tris pH 7.5
    • 150mM NaCl
    • 0.1% Tween-20: 100mL pre-made 10xTBS + 1mL Tween-20
  3. Anti-His-HRP antibody (10mL Clonetech)
    • 1x TBS-T
    • 5% milk (2.5g skim milk powder with 50mL 1x TBS-T)

Run SDS-PAGE gel

Transfer protein from gel to membrane (semi-dry-blotting):

  1. Soak 2x filter paper and gel in transfer buffer
  2. Soak PVDF membrane in 100% methanol, followed by soaking it in water, then transfer buffer; alternatively, use cellulose membrane soaked in transfer buffer
  3. Stack: filter bottom paper, PVDFmembrane, gel (from SDS-PAGE; facing down!), filter paper on top
  4. Roll out bubbles with glass pipette
  5. Attach top electrode plate
  6. Transfer 40min at 15V

Develop blot with Supersignal West pico kit (Pierce)

  1. Block the blot with Anti-His-HRP antibody buffer for one hour to overnight. Discard
  2. Incubate the blot with primary antibody (His) diluted 1:5000 (10µL in 50mL) in TBS-T and 5% milk.
  3. Wash four times 10 minutes with 1xTBS-T on an orbital shaker at room temperature.
  4. Incubate the blot with secondary antibody (HRP) diluted 1:100000 in TBS-T for 45 minutes at room temperature. Discard.
  5. Wash four times 10 minutes with 1xTBS-T on an orbital shaker at room temperature.
  6. Prepare Working Solution by mixing equal parts of the Stable Peroxide Solution and the Luminol/Enhancer Solution. Use 0.1 mL Working Solution per cm2 of membrane.
  7. Incubate the blot in Working Solution for 5 minutes.
  8. Remove the blot from Working Solution and drain excess reagent.
  9. Place the blot in clear plastic wrap or sheet protector and remove bubbles.
  10. Expose the blot to X-ray or imaging system.

Phages

BRED

Part 1. Construction of recombineering substrates: Preparing double-stranded DNA (dsDNA) (gene of interest + overhangs) by performing KOD Xtreme PCR

Part 2. Preparation of recombineering competent E.coli BL21 cells: Add plasmid

  1. Grow E.coli BL21 cells in LB medium to mid-log phase in 100 ml LB: OD600 between 0.4 and 0.6
  2. Harvested by centrifugation (3000 × g, 4 °C, 15 min).
  3. Make cells electrocompetent:
    • Concentrate culture 500-fold. Wash three times with ice-cold sterile 10% (v/v) glycerol, and suspended in a final volume of 80–300 μL.
  4. Electroporate 100–500 ng of pKD46 into aliquots of 20 μL electrocompetent cells at 1.8 kV and 25 pF using a Gene Pulser XCell Microbial System (BioRad).
  5. Recover cells with SOC and incubate for 1–2 h at 37 °C, 200 rpm.
  6. Spread cells in LB agar plates with Ampicillin (LB-Amp) and incubated overnight at 30 °C.
  7. Pick transformed E. coli BL21::pKD46 colonies and grow in fresh LB-Amp medium for a few hours.
  8. Do plasmid extraction (NucleoSpin® Plasmid (NoLid) kit, Macherey-Nagel) and digestion with the restriction enzyme BamHI-HF (New England Biolabs) to confirm the presence of pKD46.

Preparation of electrocompetent E.coli BL21(DE3)::pKD46 cells with T7

  1. Pick a colony of BL21(DE3)::pKD46 cells and grow them in 5-10 ml LB-amp O/N at 30°C
  2. Grow BL21(DE3)::pKD46 in 100mL LB-amp medium till early log-phase (OD600 ±0.4) at 30°C
  3. Induce the expression of lambda Red by pKD46 for 30 min with L-arabinose (0.1 % final concentration)
  4. Infect the cells with T7 at a multiplicity of infection (MOI) of 1-3 for the eclipse time (10 min.)
    5. MOI = (phage volume x phage titer)/ amount of cells
  5. Divide the culture over 4x50 ml tubes and centrifuge at 4°C for 15 minutes at 3000 x g. Discard the supernatant.
  6. Resuspend all the pellets in a total of 20 ml ice-cold 10% glycerol and centrifuge again for 15 minutes. Discard the supernatant.
  7. Repeat the washing step with 10 and 5 ml ice-cold 10% glycerol.
  8. Resuspend the pellet in 500µL ice-cold 10% glycerol and divide in aliquots of 100µl

Electroporation and recovery

  1. Add 100-500 ng of the dsDNA substrate to 100µL of the electrocompetent cells at 1.8 kV and 25 pF. Check time constant → should be >18 ms (19-21 ms is best)
  2. Recover the cells in 900 µl SOC medium for 1–2 h at 37 °C, 200 rpm.
  3. Mix the suspension with 3 mL soft agar and 100µL of an E.coli BL21(DE3) culture.
  4. Pour this mixture onto LB plates and incubate overnight at 37 °C

Recovery and confirmation of mutant phages

  1. Pick 18-25 individual plaques into 100µl phage buffer;
  2. Incubate at room temperature for 1-2 hr or at 4°C overnight; store plaques at 4°C.
  3. Use 1 µl of each plaque to use as a template for PCR with the flanking primers or primers specific to your insert.
  4. Use WT phage DNA (5-10 ng) as a control
  5. When you have found a positive plaque, serial dilute this plaque until 10^-7 in phage buffer and infect 300 µL BL21(DE3) with 10µL of each dilution. Add 2-3 ml top-agar and pour it over a bottom LB layer.
  6. Incubate overnight, pick at least 18 secondary plaques and screen by PCR. In addition, dissolve the plate with more than 1000 plaques in 3-5 ml phage buffer, incubate for at least 1 hr, collect the buffer in a sterile tube. Also screen this lysate for engineered phages. Repeat step 5 and 6 until you obtain a pure sample with engineered phages, confirmed by PCR using flanking primers.
  7. When a pure mutant plaque is confirmed, replate and obtain a lysate from the plate containing a web pattern. Filter sterilize the lysate.

Confirmation PCR

  1. Follow the PCR protocol for GoTaq polymerase with 35 cycles.

Preparation of phage buffer

  1. Prepare 5M NaCl by dissolving 29.22g NaCl in 100ml Milli Q water and 0.2um filter solution into a sterile container.
  2. Prepare 1M Tris-Cl, pH7.4, by dissolving 7.882g Tris-HCl in 90ml Milli Q water, adjusting pH to 7.4 with 1N NaOH, bringing final volume to 50ml and filter sterilizing through a 0.2um filter into a sterile container.
  3. Prepare 1M MgSO4 by dissolving 12.3g MgSO4-7H2O in 50ml Milli Q water and filter sterilize through 0.2um filter into sterile container
  4. Mix together 3.0ml 5M NaCl, 4.0ml 1M Tris-Cl, pH 7.4, and 1.0ml 1M MgSO4 in 92ml sterile Milli Q water in a sterile container.
  5. Filter solution through a 0.02um Anotop syringe filter into a sterile container.
  6. Final phage buffer will be 150mM NaCl, 40mM Tris-Cl, pH 7.4, 10mM MgSO4.
Bacteriophage selection method

Goal: The goal of these experiments is to select the engineered phages from the pool with wild type and engineered phages. For this CRISPR Cas9 will be used.

In Vitro gRNA design:

  1. Design primers for cloning your protospacer (target) into the pKDsgRNA plasmid. The protospacer must precede a PAM site of NGG on either strand.
    • Add this sequence to the 3’ end of the forward primer - gttttagagctagaaatagcaag
    • Add this sequence to the 3’ end of the reverse primer - gtgctcagtatctctatcactga

pKDsgRNA plasmid construction:

  1. Do two PCR reactions.
    • To amplify part 1: use your designed F primer with this primer: tttataacctccttagagctcga
    • To amplify part 2: use your designed R primer with this primer: ccaattgtccatattgcatca

Co-transformation of Cas9 plasmid and pKDsgRNA

  1. Add at least 10ng of each plasmid to 20 µl electrocompetent cells.
    • Mix plasmids well in advance.
  2. Follow the protocol for transformation of electrocompetent cells. Recover the cells in SOC medium at 30 degrees C
  3. Plate the cells on LB plates with a selection marker spectinomycin (Spec) and chloramphenicol (Cam) at 30 degrees C.

Selection of engineered phages

  1. Grow three colonies overnight in LB-Spec/Cam (60 µg/ml and 35µg/ml) at 30C
  2. Put the bacteria to grow in LB-Spec/Cam 30 µg/ml and 17.5 µg/ml final concentration at 30C until OD600=0.5
  3. At OD = 0.5 , add arabinose (0.75% final concentration) and aTC (100 ng/ml), to induce λ-Red recombinase and pCas9. Incubate for an additional 30 minutes.
  4. Make serial dilutions of the phage stock solution containing engineered phages.
  5. Plate 10µl of each dilution with 100µl bacteria in LB top-agar supplemented with arabinose (0.75% final concentration) and aTC (100 ng/ml) on LB-Spec/Cam bottom layer.
  6. Incubate overnight at 30C.
  7. Pick the plaques and screen for the mutation by PCR.
Phage infectivity assay

Aim: To evaluate potential changes in the mutant’s phage infectivity.
The latent period, eclipse time and burst size of the phages can be determined from the one step growth curve as described by Ellis and Delbrück (1939) [1].

Equipment

  • 0.6% top agar
  • LB agar plates
  • 37℃ stove
  • 37℃ shaker
  • BL21(DE3)
  • T7 wild type
  • Phage buffer (1x PBS, 1mM MgCl2, 1mM MgSO4

Protocol

Day1:

  • Put BL21(DE3) to grow O/N at 37℃ 150 rpm

Day2:

  • Grow 2 ml BL21(DE3) in 210 ml LB at 37℃, 150 rpm until an OD600 of 0.35.
  • Divide the culture over two erlenmeyers, make sure to have in each erlenmeyer exactly 100 ml culture.

Do the following steps in duplo (in each erlenmeyer with 100 ml culture)

  • Add wild type T7 or mutant phages at an MOI of 0.001. I.e. add 10µl of phage stock of 10^10 pfu/ml.
  • Incubate for 5 minutes at 37℃ 150 rpm
  • Take a sample, measure OD600 and immediately filter it with a 0.22 or 0.45 µm filter and ten times serial dilute in phage buffer until 10^-8
    • This will be your t=0 sample and adsorption control
  • Take a sample every 5 minutes for 90 minutes, measure OD600 and ten times serial dilute your sample in a phage buffer until 10^8.
  • Incubate the dilutions at RT for 1-2 hours and store them at 4℃

Day 3:

  • Aliquot 38 times 3 ml of 0.6% top agar, keep it warm so the agar does not solidify.
  • Add 300µl of fresh BL21(DE3) to each tube, mix well and immediately pour it over an LB agar plate
  • Incubate at RT for 20 minutes.
  • Divide each plate into 8 sections. Mark each section with the correlating dilution. Spot 5 µl of each dilution of 1 time point taken on day 2 on one plate. Let the spots dry and incubate the plates at 37℃ for 2-3 hours.
  • Determine the pfu/ml for each time point by counting the plaques on each plate.
    • E.g. at t=20 you see 8 single plaques at the spot with the 10^8 dilution sample, this means that the pfu at t=20 was 8/5µl *10^8 pfu/µl = 1.6 *10^8 pfu/µl = 16 * 10^10 pfu/ml.

[1] Ellis, E. L., & Delbrück, M. (1938). Supplemental Information 2: NCBI genome database accession information (PDF file). The Journal of General Physiology. doi:10.7717/peerj.6447/supp-2

Phage plaque size over time

With this experiment we want to compare the plaque size and the appearance of the plaque. Virulent strains or lytic lead to more clear plaques, thus the virulence of different phages can be compared with this experiment. In addition we can compare the speed that virions diffuse as this is indicated by the plaque size.

Equipment

  • 0.6% top agar
  • LB agar plates
  • 37℃ stove
  • 37℃ shaker
  • BL21(DE3)
  • T7 wild type
  • Phage buffer (1x PBS, 1mM MgCl2, 1mM MgSO4)

Protocols

Day 1:

  • Inoculate BL21(DE3) in fresh medium for an overnight culture at 37℃ 150 rpm.

Day 2:

  • Ten times serial dilute the T7 wildtype phage stock until 10^1, 10^2 and 10^3 pfu/ml.
  • Aliquot 3 times 3 ml of liquid 0.6% top agar in 25 ml tubes, keep them in hot water to prevent the top agar from solidifying.
  • Add 300µl of fresh BL21(DE3) overnight culture to the top agar (make sure the agar is not too hot). Immediately add 100µl of phage dilution and pour it over the LB agar plates.
  • Incubate the plates at RT for 20 minutes.
  • Incubate the plates at 37℃ for 2 hours
  • Count and measure plaques size
  • Measure plaque size.
    • After around 2 hours plaques will appear, from then onwards measure every 30 minutes and take a picture (Exact plaque formation time may vary for different phages).

RNA

qPCR for RNA
  1. Perform standard curve:
    • Prepare dilution with 2.75µM, 0.918µM, 0.306µM, 0.102µM, 0.034µM RNA (5 data points over 3 orders of magnitude, always below 100ng RNA)
      • To go to the wished pM range, these dilutions should be diluted 105 times. To do this with the least possible error, samples should be diluted first 2 times by 100. In order to perform these dilutions with the least possible error, two separated dilutions should be performed in which 3 µl of Starting dilution X will be added to 297µl of MQ water
  2. Prepare following solutions

    3. Mix 1 (One mix per RNA sample) Volumes for 1 reaction
    Reverse primer Variable
    RNA template (from highest dilution) Variable
    RNase-free H2O Up to 10 µl of the final reaction (see Table 1)
    Final volume Mix 1 Variable
    Mix 2 (One common mix for all) Volumes for 1 reaction
    Forward primer Variable
    Power SYBR Green RT-PCR Mix (2X) 5µl
    RT-enzyme mix (125X) 0.08 µl
    Final volume Mix 2 Variable
    Final reaction volume Final volume Mix 1 + Final volume Mix 2 = 10 µl

    Standard qPCR protocols demand to incubate the Reverse primer with the RNA at 65°C for 5 min inside a regular PCR machine in order to manage the binding between them. Mix 1 should always be prepared first and incubated in the mentioned conditions in PCR tubes. Right after, Mix 1 should be let at room temperature for 10 minutes. Preferably, Mix 2 should be prepared while Mix 1 is resting at room temperature.



  3. Set thermal profile in PCR for standard curve:

Stage Step Temp Time
Holding Reverse transcription 48 °C 30 min
Holding Activation of AmpliTaq Gold DNA Polymerase, UP (Ultra Pure) 95 °C 10 min
Cycling (40 cycles) Denature 95 °C 15 sec
Anneal/Extend 60°C 1 min
Melt curve (Optional) Denature 95°C 15 sec
Anneal 60°C 15 sec
Denature 95°C 15 sec
RNA electrophoresis

Preparation of the samples:

Work RNase-free! Treat your workspace with RNaseZAP prior to your experiment and work with gloves. Don't talk while handling your samples!

  1. Prepare the electrophoresis samples in 0.2 mL PCR tubes; 2 µL of 2X RNA Loading Buffer per 2 µL of sample (check the appropriate preparation for each marker).
  2. Put your samples at 90 °C for 5 minutes.
  3. Leave your samples on ice for 2 minutes. Store your samples at 4 °C when not loaded directly on the gel

Preparation of the gel:

Work clean! Handle all material labelled as EtBr contaminated with gloves. Don't take it outside of the EtBr area and don't touch anything that is not labelled as EtBr contaminated with gloves.

  1. Prepare TBE buffer: take the 10X concentrated TBE from the chemicals cabinet and dilute it 10 times with milli-Q.
  2. Weigh agarose for a 2% gel. For 100 mL, 2 g of agarose is necessary.
  3. Mix the TBE solution with the agarose and heat the solution (in a microwave) until it is completely dissolved.
  4. Add 10,000 X SYBR Safe to the solution and mix well. Meaning that for a large gel of 100 mL you have to add 10 µL of SYBR Safe.
  5. Pour the solution into the mould, making sure there are no bubbles. Add a comb to create wells for the samples. Let it solidify (~10 minutes).

RNA electrophoresis:

  1. Transfer the gel to the electrophoresis cell minding the arrow that indicates the direction of DNA/RNA migration. Remove the combs and cover it with TBE-buffer.
  2. Load the RNA ladder in the first well (check the appropriate volume for each marker) and load 4 µL of the samples in the other wells, according to the order in your lab journal.
  3. Connect the cables following the colour code and run at 80 V for 60 min.
RNA isolation (RNeasy MiniElute)
  1. Adjust the sample to a volume of 100 µL with nuclease free water.
  2. Add 250 µL of absolute ethanol and mix well by pipetting.
  3. Immediately(!) transfer the sample to an RNeasy MinElute spin column placed in a 2 mL collection tube. Centrifuge for 15 s at 8000 x g.
  4. Place the RNeasy MinElute spin column in a new 2 mL collection tube and add 500 µL RPE buffer. Centrifuge for 15 s at 8000 x g.
  5. Discard the flow-through and add 500 µL of 80% ethanol to the RNeasy MinElute spin column. Centrifuge for 2 minutes at 8000 x g.
  6. Place the RNeasy MinElute spin column in a new 2 mL collection tube and centrifuge for 5 minutes at full speed.
  7. Place the RNeasy MinElute spin column in a new 1.5 mL collection tube and add 14 µL nuclease free water. Centrifuge for 1 minute at full speed, your RNA is now in your tube.
RNA production (T7 RiboMax Promega)
Urea PAGE

Denatures secondary DNA and RNA

Preparation chamber

  1. Assemble the gel according to manufacturer's description and fix the gel in the gel-casting chamber. Use 0.5-1.5 mm thick spacers.
  2. Prepare the appropriate polyacrylamide solution. Use ultrapure urea and mix with the desired amount of acrylamide. Add TBE buffer to the gel mix to get a final concentration of 0.5-1 x TBE and fill up the volume with deionized, distilled water. Heat the solution for 20 seconds in the microwave and mix it gently.
  3. Pour the gel immediately using a serological pipette and an automatic pipette aid between the two glass plates. Avoid introducing air bubbles.Insert the comb and let the gel polymerize for 30-60 minutes.
  4. Dismount the gel from the casting chamber and assembly it to the gel apparatus
  5. Fill the lower buffer chamber with running buffer (0.5-1 x TBE) that the glass plates will be submerged 2-3 cm with buffer. Fill the upper buffer chamber up to the top of the gel with running buffer.
  6. Carefully remove the comb and rinse the wells with running buffer by using a pipette and gel loading tips.
  7. Attach the lid of the gel system and plug in the cables to a high voltage power supply. Before you can load your samples you have to pre run the gel for at least 30 minutes to heat the gel up and to remove remaining urea from the gel. The optimal temperature should be between 45-55 °C.

Preparation samples

  1. Add 2 x gel loading mix to your sample.
  2. Denature the samples between 70-90 °C for a few minutes.

Run gel

  1. Rinse pockets thoroughly
  2. Transfer the samples into pockets.
  3. Run gel at constant voltage