Team:Tsinghua/Experiments
Experiments
Detection and Visualization of Biofilm Growth
Bacterial strains
P. aeruginosa biofilm culture experiments were performed with a single typical P. aeruginosa biofilm-forming Strain PAO1. To observe the biofilm under the fluorescence microscope, we select a PAO1 strain with chromosomally expressed green fluorescent protein (GFP).
Culture condition
In our project, P. aeruginosa biofilm culture experiments were performed mainly in petri dishes with M9 liquid culture medium (with glucose) at 37 °C. M9 is a nutrient-limited medium which can promote the biofilm growth. Because in nutrient starvation and other adverse conditions P.aeruginosa tend to form biofilm in order to help them resist the adverse environment and survive. Different medium flow conditions were also used, including still culture plate, shaking culture plate (at different rate), microfluidic conditions, which would be further explained in each experiment.
Biofilm detection
To quantify the P. aeruginosa biofilm growth, we use different methods to detect and analyze the biofilm. First, crystal violet staining were used to determine the biofilm quantity at the bottom of the well plate. Second, we used Olympus IX73 inverted fluorescence microscope to observe the growth of PAO1-GFP Biofilm. For quantitative analysis, we would calculate the area proportion of GFP fluorescence in the entire petri dish. Third, we used Nikon A1R HD25 confocal laser scanning microscope to observe the biofilm with fluorescent signal more precisely, and collected with NIS Elements AR software. To further quantitatively analyze the confocal images, we use the area proportion of GFP fluorescence and the total/average GFP intensity as the growth index of biofilm.
Biofilm visualization
We used Nikon A1R HD25 confocal laser scanning microscope to obtain the biofilm planar images. To further demonstrate the growth and degradation process of biofilm, we used Z-stacking to reconstruct the three-dimensional biofilm images from the planar image on the same Z-axis using the NIS Elements AR software. We also used Time-loop scanning to generate the movie of biofilm growth/degradation over a period of time. The combination of Z-stacking and Time-loop visualization can indicate more detail of the dynamic and the whole procedure of biofilm growth/degradation. And the Z-stacking can also ensure reduce the influence of focal plane excursion in biofilm growth/ degradation process.
Biofilm Degradation Using SNP
Degradation analysis of crystal violet staining
We first verified the effectiveness of NO in biofilm degradation, P. aeruginosa biofilm culture experiments were performed mainly in petri dishes. Degradation experiments of P.aeruginosa biofilms at different concentrations of NO were carried out using chemical donors of NO—Sodium Nitroprusside (SNP) (all the biofilms were cultured for 24 hours)
Stock cultures of PAO1-GFP were streaked onto Luria-Bertani (LB) culture plates, and incubated for 24 hours at 37°C 220rpm. Single colonies of each strain were transferred into separate tubes containing 3 mL of sterile LB broth, and grown overnight in a shaker at 37 °C for injection into 96-well plate.
The degradation experiment was performed in 96-well plate. The bacterial culture from the tube was adjusted to OD600=1.0, and was diluted 1000-fold in M9 liquid culture medium (with 0.4% glucose). The deluted culture would be injected 90uL in 80 of the 96-well plate and grown for 24h at 37 °C 120rpm for biofilm growth. To prevent the culture solution from evaporating, we added 200uL of water to the wells on the edge of the 96-well plate.
The 200mg/mL(671mM) SNP solution was diluted in M9 medium by a factor of 10 each time. After 24h of biofilm growth, we add 10uL SNP solution at different concentration to each column in the 96-well plate, B11-G11 was used for control. (Figure A) The 96-well plate was then incubated for 24h at 37 °C 120rpm for biofilm degradation.
Figure A. The 200mg/mL SNP solution was diluted in M9 medium by a factor of 10 each time（B11-G11 was used for control, wells on the edge was added 200uL of water）
After another 24h for degradation , 80uL of the supernatant from each well with SNP was carefully extracted and measured with GFP signal (A513, excitation 488 nm, emission 513 nm). Wells containing biofilms were washed twice with phosphate buffered saline (PBS) and fixed with methanol for 15 min. Then the wells were washed twice with PBS and dry for 10 min at 37℃. After drying the wells were stained for 15 min with 100uL of 1% crystal violet. The wells were washed again three times with water, and the remaining crystal violet dissolved in 200uL of absolute ethanol for 3 min at 37℃ and then shook for 2 min. Biofilm formation was quantified by measurement of the OD595.
To confirm the degradation effect of NO, sodium hypochlorite, a disinfectant, was used as a positive control. Under the same culture conditions, biofilm grown for 24h was cultured with sodium hypochlorite concentrations ranging from 0.5% to 5×10-9%.After 24 hours, the degree of biofilm degradation was detected.
After investigation, we used the ratio of biofilm (in situ crystal violet staining absorbance at) to the biomass of suspended bacteria (fluorescence signal of GFP in supernatant) to reflect the degradation of biofilm.
Degradation analysis of planar fluorescence signal
We further confirm the biofilm degradation using the Nikon A1R HD25 confocal laser scanning microscope to obtain the biofilm planar images. Stock cultures of PAO1-GFP were streaked onto Luria-Bertani (LB) culture plates, and incubated for 24 hours at 37°C. Single colonies of each strain were transferred into separate tubes containing 3 mL of sterile LB broth, and grown overnight in a shaker at 37 °C before injection into confocal petri dishes. We used 5 confocal petri dishes with SNP concentration from 20mg/mL to 2ug/mL..The culture in the tube was diluted 1000-fold in M9, and each petri dish was injected with 2mL. SNP was added after 24 hours at 37°C 50rpm for biofilm growth. Each culture plate was washed with 10mL of PBS after 24h of degradation before imaging. Five blocks with an area of 100×100 um were randomly selected from each confocal petri dish to detect the average fluorescence intensity of GFP in the block under 488nm fluorescence. Biofilm planar graphs and were obtained using NIS Elements AR software for Nikon A1R HD25 confocal laser scanning microscope.
Degradation analysis of 3D time-lapse images
In order to visually observe the degradation process of biofilm, Nikon A1R HD25 confocal laser scanning microscope to obtain the biofilm 3D images. Stock cultures of PAO1-GFP were streaked onto Luria-Bertani (LB) culture plates, and incubated for 24 hours at 37°C. Single colonies of each strain were transferred into separate tubes containing 3 mL of sterile LB broth, and grown overnight in a shaker at 37 °C before injection into confocal petri dishes. The culture in the tube was diluted 1000-fold in M9, and each petri dish was injected with 2mL.We used SNP concentration of 20ug/mL. SNP was added after 24 hours at 37°C 50rpm for biofilm growth. During imaging, ten blocks with an area of 50×50 um were randomly selected from, and the biofilm growth in the blocks was observed using the combination of Z-stacking and Time-loop visualization under 488nm fluorescence. Each step on the Z-axis for Z-stacking is 1.5um and the total Z length was 15um. We recorded the biofilm degradation continuously for 14 hours using the Time-loop visualization. Biofilm 3D time-lapse movies were obtained and cropped using NIS Elements AR software for Nikon A1R HD25 confocal laser scanning microscope.
Biofilm Degradation Using Engineered Bacteria
Coculture of E.coli and P.aeruginosa
Coculture experiments were firstly performed with a single typical P. aeruginosa biofilm-forming Strain and an E.coli strain. An E. coli BL21-mCherry strain inserted with plasmid pUC encoding mCherry fluorescent proteins was used to study dual- species biofilm growth behavior. This strain is derived from E. coli K-12. A P. aeruginosa PAO1-GFP strain with a chromosomally expressed green fluorescent protein (GFP) was also used.
Stock cultures of P. aeruginosa and E. coli were streaked onto Luria-Bertani (LB) culture plates, and incubated for 24 hours at 37°C. Single colonies of each strain were transferred into separate tubes containing 3 mL of sterile LB broth, and grown overnight in a shaker at 37 °C for injection into confocal petri dishes.
The coculture experiment was performed in 4 petri dishes with M9 medium (with 0.4% glucose) and different time of inoculation. The PAO1-GFP culture in the tube was adjusted to OD600=1.0 and diluted 1000-fold in M9 (with 0.4% glucose), and each petri dish was injected with 2mL. After different time of growth (0h/8h/16h/24h), 2uL of BL21-mCherry (adjusted to OD600=1.0) were inoculated into each plate. The total time of coculture was 48h.
Each culture plate was washed with 10mL of PBS after 48h before imaging. Biofilm micrographs were obtained using Nikon A1R HD25 confocal laser scanning microscope, and collected with NIS Elements AR software. P. aeruginosa was imaged by GFP fluorescence, while E.coli was imaged by constitutively expressed mCherry fluorescence. Fluorescence was stimulated at 488nm and 638nm, respectively. Planar image of the two channel was collected separately. The three-dimensional biofilm images were generated from the planar image stacks using the image processing software. We randomly select 5 1024×1024 pixels (1 pixel=0.62um) blocks in the image and the area ratio of mCherry/GFP was calculated.
Coculture experiment of biofilm degradation using engineered bacteria
In order to verify the effectiveness of our engineered bacteria, we used our NOS-expressing E.coli—from BL21 DE3 strain to perform coculture experiment. To visually observe the degradation process of biofilm, Nikon A1R HD25 confocal laser scanning microscope to obtain the biofilm 3D images. Stock cultures of PAO1-GFP were streaked onto Luria-Bertani (LB) culture plates, and incubated for 24 hours at 37°C. Single colonies of each strain were transferred into separate tubes containing 3 mL of sterile LB broth, and grown overnight in a shaker at 37 °C before injection into four-divided confocal petri dishes. The culture in the tube was diluted 1000-fold in M9, and each area of the petri dish was injected with 500uL.
The BL21-NOS was streaked onto Luria-Bertani (LB) culture plates, and incubated for 24 hours at 37°C. Single colonies of each strain were transferred into separate tubes containing 3 mL of sterile LB broth, and grown for 5h in a shaker at 37 °C until OD600=0.5. The BL21-NOS culture was then diluted 100-fold in M9 (with 0.4% glucose, 0.45mM of ALA( Δ-aminolevulinic acid), 0.5mM of Arg and 0.5mM of IPTG). After 24 hours at 37°C 50rpm for biofilm growth, the original M9 medium was removed and replaced with 500uL M9 containing 100-fold diluted BL21-NOS. Then degradation was set for another 24h. Two another area, one with ALA, Arg, IPTG, another with none, were also set for control(Figure B). Each area was washed with 2mL of PBS after 24h of degradation before imaging. We randomly select 3 1024×1024 pixels (1 pixel=0.62um) blocks in the image in each area. And the biofilm growth in the blocks was observed using the combination of Z-stacking and Time-loop visualization under 488nm fluorescence. Each step on the Z-axis for Z-stacking is 1.5um and the total Z length was 15um. We recorded the biofilm degradation continuously for 14 hours using the Time-loop visualization. Biofilm 3D time-lapse movies were obtained and cropped with 110×110um (xy) using NIS Elements AR software for Nikon A1R HD25 confocal laser scanning microscope.
Figure B. The BL21-NOS culture (diluted 100-fold in M9 with 0.4% glucose, 0.45mM of ALA( Δ-aminolevulinic acid), 0.5mM of Arg and 0.5mM of IPTG) was added into PAO1-GFP biofilm for degradation, control groups were set in two other area of the four-divided petri dish.
Hardware
Bacterial strains
P. aeruginosa biofilm culture experiments were performed with a single typical P. aeruginosa biofilm-forming Strain PAO1. To observe the biofilm under the fluorescence microscope, we select a PAO1 strain with chromosomally expressed green fluorescent protein (GFP).
Stock cultures of PAO1-GFP were streaked onto Luria-Bertani (LB) culture plates, and incubated for 24 hours at 37°C 220rpm. Single colonies of each strain were transferred into separate tubes containing 2 mL of sterile m9 broth, and grown overnight in a shaker at 37 °C for injection into the hardware.
Hardware preparation
First, we connected all the tubes and element, closed the valve of the infusion bag, and made sure all the hardware was airtight. Then, 100ml 75% ethyl alcohol was added to the infusion bag in the asepsis work table, along with the pump being turned up for 1h to circulate the ethyl alcohol and disinfect the hardware. Next, we opened valve of the infusion bag and drain out the ethyl alcohol. To make sure the left ethyl alcohol was too little to influence the PAO1-GFP which we planned to add next, we used 100ml m9 broth to wash the hardware twice, each for 20 minutes. Finally, 100ml m9 broth along with 1ml PAO1-GFP solution were added into the hardware through the valve, and the cultivation could start.
Cultivation and observation
The whole hardware was moved to an inverted microscope and the cultivation was conducted there. Before the cultivation, the main element was put on the console of the microscope, so that all the cultivation process could be recorded by the microscope in a real time pattern. During the cultivation, the pump was working all the time and the flowing velocity parameter was controlled at 13, a rather suitable flowing velocity to imitate most drain tubes in our daily lives.
Quorum Sensing
C4-HSL Detection
C4-HSL detection experiment were performed with a single typical P. aeruginosa biofilm-forming Strain PAO1 and an E.coli strain. An E. coli DH5α strain was used to set a control for biofilm growth behavior. This strain is derived from E. coli K-12.
Stock cultures of P. aeruginosa and E. coli were streaked onto 3mL of Luria-Bertani (LB) culture plates, and incubated for 24 hours at 37°C. Single colonies of each strain were transferred into separate tubes containing 3 mL of sterile LB broth, and grown overnight in a shaker at 37 °C for injection into confocal petri dishes. The PAO1-GFP culture in the tube was adjusted to OD600=1.0 and diluted 1000-fold in M9 (with 1% glucose). The C4-HSL detection experiment was performed in 20 petri dishes with 3mL M9 with 1% glucose and different time of cultivation (including DH5α for 48h, PAO1 for 24h,48h,72h).
Before detection, 1.5mL culture extract was centrifuged at 12000rpm for 5min and 100μL of the supernatant was precipitated with 800μL of acetonitrile. A QTRAP Liquid chromatography-mass spectromer was used for the detection of C4-HSL. A standard sample of crystalized C4-HSL was used to draw the standard curve at 0.1/0.2/0.5/1/2/5/10/20/50/100ng of C4-HSL sample
Setting of QTRAP in C4-HSL detection
C4-HSL induce and EGFP detection
After transformation, the single colony was picked and inoculated into 2mL chloramphenicol LB to culture overnight at 37℃. Then 60 times diluted of the culture solution was prepared. After 60-90min of 220 rpm shake at 37℃, the OD600 of the solution reached 0.3-0.5. Then solution was separated into 3 groups (500 μL) and meanwhile different inducers (0.5 μL) were added. After 4 hours incubation at 37℃, the cell culture was aliguoted into 96-well plate, 100 μL per well, 4 wells per group. VARIOSCAN FLASH(TM) microplate reader was used to measure the RFU(Ex 490 nm, Em 525 nm).
Plasmid
The composite part BBa_K1893003 as the C4-HSL report system was synthesized from in BGI QINGLAN BIOTECH according to the sequence offered on the website. The pSB1C3 backbone derived from the distributed part BBa_R0071. After PCR, these two elements were constructed via NEBuilder HiFi assembly(the protocol referred to https://international.neb.com/products/e2621-nebuilder-hifi-dna-assembly-master-mix#)
Primers:
For lineage pSB1C3:
F: tactagtagcggccgctgcag
R: ctctagaagcggccgcgaattc
For biobrick:
F:gaattcgcggccgcttctagaggatacagatcttttacagctagctcagtcc
R:ctgcagcggccgctactagtaggttggcagtgactccgtctcta
1.Set up the following reaction on ice:
2.Incubate samples in a thermocycler at 50°C for 15 minutes (when 2 or 3 fragments are being assembled) or 60 minutes (when 4–6 fragments are being assembled). Following incubation, store samples on ice or at –20°C for subsequent transformation.
NOS cloning
Bacterial strains and Culture
The Bacillus Subtilis used for NOS gene source is wild type Bacillus Subtilis 168 from Prof. Chen’s Lab. The E.coli used for plasmid amplification is DH5α from Tiangen (China). The E. coli used for NOS protein expression is BL21 (DE3) from Tiangen (China). All the strains are cultured at the LB. The transformed bacterial will be cultured at LB with 100μg/ml kanamycin at 37℃.
Competent Cells
We bought the competent cells from the company Tiangen (China). The transformation method of the receptive cells is based on the protocol given by the company. Here's it detail step: The competent cells were taken from the -80℃ refrigerator and placed in an ice bath. Add 1μg plasmid and ice bath for 30min. The bacteria were heated for 45s and immediately placed in an ice bath for 2min. LB without antibiotic is added as nine times of the competent cells. The bacteria were shaken to culture 45min. The bacteria are coated on a corresponding antibiotic plate and cultured at 37℃.
Primer
We synthetic the primer from Ruibiotech(China) as follow sequence
F: AGCTTGCATGCCTGCAGGTAATGGCTTGGAGAAACAGCA
R: CGACCGGTACCCTACTCATAAGGCTTATCTTGATAAAAATAGTTCG
The primer concentration is 10pmol/μL and stored at -20℃.
PCR
A single colony was selected from the plate and added to 2ml LB. The bacteria were shaken to culture for 3h or longer. The PCR is operation according to the following system in a PCR tube.
Bacterial culture 1μL
ddH2O 20μL
F primer 2μL
R primer 2μL
Q5 premix(TAKARA China) 25μL
Set PCR at the Tm from Snapgene and the annealing extension time (30s/kb).
DNA electrophoresis
We get 50XTAE buffer from Coolaber(China). We added 20ml of the reagent and 980ml ddH2O to prepare 1XTAE. Then we add 30ml 1XTAE and 0.3g agarose for 8 lines electrophoresis and 70ml 1XTAE and 0.7g agarose for 17 lines electrophoresis. Microwave until the agarose melts. Then add 0.01% SYBR Safe DNA gel stain (Invitrogen China) and pour the solution into the trough and insert the comb. Stay out of the light and let it cool. Pull out the comb, put the gel in the electrophoresis tank. Pour in 1XTAE buffer until the solution is submerged.
Add the 5x loading dye (GelPilot) to the DNA sample and mix it. Add 10μl DL 2000 marker from TAKARA (China). Loading the sample mixture and run the electrophoresis at 300V for 15min. The gel was placed under ultraviolet light to observe the band.
DNA Digests
We get the PET28-a from former Tsinghua iGEM team and restriction enzyme from BioLabs (New England). The DNA digests is operation according to the following system in a PCR tube.
DNA sample 1μg
NEB 3.1buffer 2μl
BamHI 1μl
NcoI 1μl
Add ddH2O to final volume 20μl
Incubate the mixture at 37℃ for 1h.
DNA ligation
We get the reagents from BioLabs (New England). The DNA ligation is operation according to the following system in a PCR tube.
Vector 50μg
Insert fragment 37.5μg
DNA ligation buffer 2μl
DNA ligase 1μl
Add ddH2O to final volume 20μl
Incubate the mixture at 37℃ for 20min.
IPTG induce
Monoclones were selected and added with 2mlLB (containing 100μg/ml kanamycin). overnight culture at 37℃ was prepared with 220rpm shaking. Arginine was added to 40ml LB(containing 100μg/ml kanamycin) to final 0.5mM concentration. ALA was added to final 0.45mM concentration and 400μl microbial was added. Then Incubate at 37℃ until OD600=0.5. Absorb half of the liquid and add it to the new conical flask as control. IPTG was added to the induced group to final 0.5mM concentration. Then incubate at 28℃.
NO Detection
We buy the Total No detection kit from Beyotime (China)
After the addition of IPTG for 0,1,2,3,4 and 5 hours, 1ml liquid was taken out respectively. Centrifuge at 12000rpm for 1min. Take 60μl of supernatant and add it to the 96-well plate. Repeat for three times.
We diluted 1M sodium nitrite with LB to 0μM ,1μM ,2μM,5μM ,10μM ,20μM,40μM,60μM,80μM to make a standard solution
Then we added 5μl 2mM NADPH, 10μl FAD, 5μl Nitrate Reductase in each hole. We incubated the plate at 37℃ for 30min. We added 10μl LDH buffer, 10μl LDH in each hole. We incubated the plate at 37℃ for 30min. Finally, we added 50μl Griess Reagent I, 50μl Griess Reagent II in each hole and detected OD540 using enzyme standard instrument
Western blot
After the addition of IPTG for 0,1,2,3,4 and 5 hours, 1ml liquid was taken out respectively. Centrifuge at 12000rpm for 1min. The mass of the bacteria was measured. For 1mg, added 1μl of 2Xloading buffer and suspension the bacteria. Then heat the solution at 100℃ for 10min.
The sample was loaded at the 4% stock gel and 12.5%% separation SDS-PAGE gel. Run the electrophoresis at 140V for 20 min, then changed voltage to 160V for 80 min.
Proteins were transferred to NC membrane by wet transfer membrane method at 300mV, 2h. After that, the NC membrane was cut between the 25-48KD. The cut membrane was incubated with 10ml 8% milk (TBST dissolved) at 37℃ for 1h. Then the 1mg/ml His-tag Mouse Monoclonal Antibody(YTHX) was diluted in 8% milk (TBST dissolved). The NC membrane was added to the 10ml diluted first antibody at 4℃ for overnight. Then the NC membrane was washed with TBST at room temperature for 10min for three times. The 100μg/ml Goat Anti-mouse IgG(H&L)-HRP Conjugated (EASYBIO) was diluted in TBST. The NC membrane was added to the 10ml diluted second antibody at 37℃ for 1h. Then the NC membrane was washed with TBST at room temperature for 10min for three times. The protein signal was obverse with Western Lighting ECL Pro (Tamper Evident seal)
Assemble of C4-HSL-NOS system
Here we constructed the C4-HSL-NOS system via NEBuilder HiFi assembly. The NOS gene was from our part BBa_K3369000.
Primers:
For biobrick:
F:gaattcgcggccgcttctagaggatacagatcttttacagctagctcagtcc
R:ttaagctactaaagcgtagttttcgtcgtttgcagcgatgagacccagcgccgc
For biobrick:
F:AAAATCAGACCGACCATTACGAT
R;ctgcagcggccgctactagtaTTACTCATAAGGCTTATCTTGATAAAAATAGTTC
After assembly, an unexpected missense mutation was occurred.
Therefore we conducted a single base mutation via PCR.
Primers:
F:ttacttcgcgttatgcaggct
R:ctgcagcggccgctact
After PCR, the product is incubated with 2μL Cutsmart buffer(NEB) and 1μL Dpn1 for 20min to digest the template. The ligation reaction was conducted with the protocol below.
Self ligation μL
Template (100ng)
H2O
T4 PNK 0.5
T4 ligase buffer 2
T4 ligase 1
All 20
The sequence result proved our success on fixing this point mutation. Due to the limited time, the characterization of this part is still needed to be conducted in the future.
Assemble of NO reporter system
The NO-sensing system is proposed to monitor the progress of the NO promoted biofilm dispersion and verify the production of NO. It’s made of the hmp promotor phmp, which has been testified that can be activated by NO or other nitrogen oxides and the reporter gene EGFP. The phmp sequence was cloned from E.coli genome and the EGFP was cloned from pEGFP plasmid.
At first we used the phmp sequence got from the ECOCYC database , which locates in front of the hmp gene and its length is 150bp ( this phmp is referred as phmp1). We replaced the promoter of the plasmid pEGFP by phmp1 and transformed it into the E.coli. After transformation we tested the plasmid’s activity and the protocol is shown below. phmp1 showed no activity.
Then, after referring previous works , we prolonged the phmp’s length to 400bp (this phmp is referred as phmp2). We replaced the promoter of the plasmid pEGFP by phmp2 and transformed it into the E.coli. Here phmp2 showed no activity too.
Finally, we used the NEBuilder® HiFi DNA Assembly Cloning Kit to make the seamless phmp2-EGFP sequence. We inserted the sequence into plasmid pUC19 and transformed it into E.coli. Then we found this sequence showed no activity also.
It’s confused that three versions of NO-sensing system all can’t work, for the testing protocol had been demonstrated to be effective, reason of the failure might be that we didn’t use strains in which the hmp gene was knocked, for the hmp enzyme may decomposed the nitrogen oxides and inhibit the expression of EGFP.
Test of NO sensing system in BL21/ DH5ɑ
Here we tested the activity of the NO-sensing plasmid in E . Coli strains BL-21(DE3)/ DH5ɑ.
After transformation, the single colony was picked and inoculated into 3.5mL LB without antibody. After 2h of 220 rpm shake at 37℃, the OD600 of the E.coli reached 0.7. Next, the solution was separated into six groups (500 μL per group) and NO provider (We used SNP---Sodium nitroprusside) in different volumes were added to make a concentration gradient (the SNP concentration in six groups is 0, 10μM, 30μM, 50μM, 70μM, 90μM respectively) and all the groups were filled to 1ml by LB. After 2,4,12 hours incubation, 250μL solution was taken out and the EGFP’s expression was measured respectively.
1