Team:Tuebingen/Notebook

Notebook

Week 1 (27 Jul - 31 Jul)

Objectives:

• Moving to lab and organizing materials
• Resuspending of primers and DNA fragments
• PCR removal of extra base pairs (bp) of fragments B and E (Table 1)

Resuspending primers and DNA fragments (Table 1):
(Lea, Florian)

• Resuspensions performed with nuclease-free water (H2ONF)
• Primer stock concentration: Set to 100 µM
• Primer working solution concentration: Set to 10 µM
• Fragment stock concentration: Set to 10 ng/µl

Label	Fragment	Found in Part ID(s):
A	Anderson Promoter - B12-Riboswitch - ssRA Tag	BBa_K3510006, BBa_K351007
B	Tet-Inverter System	BBa_K3510006, BBa_K351007
C	GFP - Terminator	BBa_K3510006
D	mRFP - Terminator	BBa_K351007
E	Mn Promoter - Mn Riboswitch	BBa_K3510002, BBa_K3510003
F	FAST - Chromoprotein - Terminator	BBa_K3510002, BBa_K3510004
G	FAST - Phytochelatine-Terminator	BBa_K3510003, BBa_K3510005
H	Anderson Promoter - Mn Riboswitch	BBa_K3510004, BBa_K3510005
Label	Primer	Sequence (5' --> 3')
1	GFP-Terminator (for)	gtgatagagatactgagcacatgcgtaaaggcgaagagctg
2	GFP-Terminator (rev)	gggttttcccagtcacgacgttgtaaaacgacggccagtgaattctataaacgcagaaaggcccaccc
3	mRFP-Terminator (for)	gtgatagagatactgagcacatggcttcctccgaagacg
4	Tet-Inverter system with GFP (for)	cgctctggctgcttaataaaaagaggagaaatactagatgtccagattagataaaagtaaag
5	Tet-Inverter system with GFP-Terminator (rev)	gctcttcgcctttacgcatgtgctcagtatctctatcactgataggga
6	Tet-Inverter system with mRFP-Terminator (rev)	cgtcttcggaggaagccatgtgctcagtatctctatcactgataggg
7	Anderson Promoter - B12-Riboswitch - ssRA Tag (for)	cagctatgaccatgattacgccaagcttgcatgcctgcagttgacggctagctcagtcctagg
8	Anderson Promoter - B12-Riboswitch - ssRA Tag (rev)	ctagtatttctcctctttttattaagcagccagagcgtagttttcg
9	mRFP-Terminator (rev)	gggttttcccagtcacgacgttgtaaaacgacggccagtgaattctataaacgcagaaaggcccaccc
10	Tet-Inverter system with -mRFP-Terminator (for)	cgctctggctgcttaataaaaagaggagaaatactagatgtccagattagataaaag
11	Anderson Promoter-Mn Riboswitch (for)	gggttttcccagtcacgacgttgtaaaacgacggccagtgaattcttgacagctagctcagtcctaggtac
12	Anderson Promoter-Mn Riboswitch (rev)	ccaaaggcaacatgctccatgacaatgtcctgaccgggg
13	Mn Promoter-Mn Riboswitch (for)	gggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgtttcaactcaataagttatgaatttagccaaagctatg
14	Mn Promoter-Mn Riboswitch rev)	ccaaaggcaacatgctccatgacaatgtcctgaccgggg
15	FAST-Phytochelatine - Terminator (for)	ccccggtcaggacattgtcatggagcatgttgcctttggc
16	FAST-Phytochelatine-Terminator (rev)	caatttcacacaggaaacagctatgaccatgattacgccaagctttataaacgcagaaaggcccaccc
17	puc19 M13 fwd (colony PCR)	cccagtcacgacgttgtaaaacg
18	puc19 M13 rev (colony PCR)	agcggataacaatttcacacagg
19	Mn Promoter-Mn Riboswitch (for) (PCR IDT bp removal)	gtttcaactcaataagttatgaatttagccaaagct
20	Mn Promoter-Mn Riboswitch (rev) (PCR IDT bp removal)	gacaatgtcctgaccggggt
21	Tet-Inverter system (for) (PCR IDT bp removal)	aaagaggagaaatactagatgtccagattagataaaagtaaag
22	Tet-Inverter system (rev) (PCR IDT bp removal)	gtgctcagtatctctatcactgatagggat

PCR removal of extra base pairs (bps) of fragments B and E:
(Lea, Benedikt, Anirudh)

To order fragments B and E (Table 1) from Integrated DNA Technologies (IDT), we had to reduce their complexity score by adding additional bps to both ends. To get rid of these additions, we designed primers to exclude them during amplification via PCR (Protocol 1).

PCR was analyzed by gel electrophoresis (Protocol 2): Since the overhangs of the ordered fragments were only 10 bp for each fragment, this cannot determine whether the PCR successfully eliminated them. However, with bands at desired positions (Fig. 1: ~1000 bp for fragment B / 500 bp for fragment E) it shows that the PCR worked in general. The PCR products from this step were then called Bstock (Bs) and Estock (Es).

Figure 1: Gel electrophoresis of IDT-overhang removal PCR. Gel loaded (from left to right): GeneRuler 1kb ladder - Fragment Bs - Fragment Es.

Week 2 (03 Aug - 07 Aug)

Objectives:

• Creation of Gibson overhangs for fragments E, F, and H

Creation of Gibson overhangs for fragment E, F, and H::
(Anirudh, Sophia)

Creation of Gibson overhangs for fragments E, F, and H was attempted with 25µl PCR reactions according to Protocol 1 and the PCR products were analyzed according to Protocol 2. Fragments H and E had a gel band at the correct size, but for fragment E, unpurified Es was used as a template, so it was decided to repeat that PCR. Fragment H was directly purified and eluted in 10 µl elution buffer (Protocol 3). Fragment F did not show a band at the desired size (Fig. 2).

Figure 2: Gel electrophoresis of Gibson-Overhang PCR. Gel loaded (from left to right): GeneRuler 1kb ladder - Fragment E - Fragment F - Fragment H.

Week 3 (10 Aug - 14 Aug)

Objectives:

• Creation of Gibson overhangs for fragment F:
• Increase in extension time + variation of template DNA
• Gradient PCR
• Ampicillin working solutions

Creation of Gibson overhangs for fragment F:
(Andreas, Luise)

PCR for creation of Gibson overhangs for fragment F was repeated (Protocol 1) with some variations. The extension time was prolonged to 30s following the kit’s suggestion of 15-30s/kb for fragments larger than 1 kb (F = 1.3 kb). For template DNA, three different types were used:

• The PCR product of the first Gibson overhang PCR for F
• DNA of the IDT stock
• H2ONF as a negative control

Analysis of the PCR (Protocol 2) showed no desired band (Fig. 3).

Figure 3: Gel electrophoresis of Gibson-Overhang PCR of fragment F. Gel loaded (from left to right): Benchtop 1kb ladder - negative control - Fragment F (template IDT Stock) - Fragment F (template F from previous PCR).

Additionally, a gradient PCR with the following temperatures was conducted: 57.8 / 59.1 / 60.5 / 61.8 / 63.1 / 64.2 °C
The PCR (Protocol 1) was performed again with 30s extension time, but in the subsequent gel electrophoresis (Protocol 2) no DNA was visible at all, except for the ladders.

Ampicillin working solutions and plates: :
(Andreas)

• 500 µl aliquots of 100 mg/ml (w/v) working solutions were stored at -20 °C
• Selective agar plates with a final ampicillin concentration of 100 µg/mL were poured with approximately 25 ml each and stored at 8 °C
• Note: Due to rapid degradation of ampicillin, selective agar plates were always prepared fresh for new experiments

Week 4 (17 Aug - 21 Aug)

Objectives:

• Creation of Gibson overhangs for fragments A, B, C, and D
• Creation of Bs and Es
• Gradient PCRs for fragment F
• Different PCR template and primer parameters for fragment H
• Isolation of plasmid pUC19
• Creating a larger stock of pUC19

Creation of Gibson overhangs for fragment A, B, C, and D:
(David, Aaron, Flo)

Since B is contained in two different Gibson Assemblies, two versions with different overhangs were required: B1 and B2. The PCRs were done according to Protocol 1 and analyzed according to Protocol 2. The desired specific bands were visible for A, B2, C, and D, but strong primer clouds were also present (Fig. 4 A). These primer clouds were still visible after purification (Fig. 4 B) (Protocol 3). B1 had the wrong size (below 500 bp instead of 940 bp). In addition, both B1 and B2 were amplified with unpurified Bs as template DNA, and were therefore repeated later.

Figure 4: A: Gel electrophoresis of Gibson-Overhang PCR of fragment A, B1, B2, C, D. Gel loaded (from left to right): Benchtop 1kb ladder - Fragment A - Fragment B1 - Fragment B2 - Fragment C - Fragment D
B: Gel electrophoresis of purified Gibson-Overhang PCR of fragment A, C, D, and digested pUC19 DNA with EcoRI. Gel loaded (from left to right): Benchtop 1kb ladder - Fragment A - C - D - test digest culture 1 - culture 2 - culture 3 - culture 4.

After amplification (Protocol 1) and purification (Protocol 3) of new Bs and Es, the Gibson-Overhang PCR for fragments B1 and B2 were repeated (Protocol 1). This time, both PCRs yielded the desired gel bands. An additional unspecific band was detected at around 750 bp in both cases. E was also amplified for Gibson overhangs, and a band was visible at the correct size (Fig. 5 A).

Different PCR template and primer parameters for fragment H:
(Andreas, Aaron, David)

Since the PCR for fragment H was successful, we used it to try different PCR parameters (primer and template concentrations) to potentially optimize the protocol. Protocol 1 was used with the following combinations:

• H1: 10 ng DNA + 0.2 µM per primer
• H2: 5 ngl DNA + 0.2 µM per primer
• H3: 10 ng DNA + 0.25 µM per primer
• H4: 5 ng DNA + 0.25 µM per primer

No pattern was apparent (Fig. 5 B).

Figure 5: A: Gel electrophoresis of Gibson-Overhang PCR of fragments B1, B2, and E. Gel loaded (from left to right): GeneRuler 1kb ladder - Fragment B1 - Fragment B2 - Fragment E.
B: Gel electrophoresis (Protocol 2) of Gibson-Overhang PCR of fragment H with different template and primer concentrations. Gel loaded (from left to right): H1 - H2 - H3 - H4 - nothing - GeneRuler 1kb ladder.

Gradient PCRs fragment F:
(David, Aaron, Florian)

Second gradient PCR (Protocol 1, 30s extension time) for fragment F with temperatures 63.5 / 64.9 / 66.1 / 67.2 / 68.0 / 68.5 °C. A band approximately at the correct size (1.3 kb) is observable for the 68.5 °C sample (Fig. 6) (Protocol 2).

Figure 6: Gel electrophoresis of Gradient PCR fragment F. Gel loaded (from left to right): GeneRuler 1kb ladder - Fragment F 63.5 - 64.9 - 66.1 - 67.2 - 68.0 - 68.5 °C - ladder.

Because of the detected band between 1-1.5 kb at 68.5 °C, a third gradient PCR (Protocol 1, 30s extension time) for fragment F was set up with higher temperatures (68-72 °C). Additionally, duplicates were performed with 5 µl GC-Enhancer per 25 µl reaction (5 µl H2ONF were substituted). The gel image (Fig. 7) (Protocol 2) suggests an increase in DNA yield with GC enhancer, but the specific band is not visible in either case.

Figure 7: Gel electrophoresis of Gradient PCR fragment F. Gels loaded (from left to right): A: Fragment F without GC enhancer: GeneRuler 1kb ladder - 68.0 - 69.1 - 69.9 - 71.2 - 72.0 °C - ladder.
B: Fragment F with GC enhancer: GeneRuler 1kb ladder - 68.0 - 69.1 - 69.9 - 71.1 - 72°C

Isolation of plasmid pUC19:
(Aaron, David, Lea)

To obtain pUC19 plasmid DNA to use as a vector backbone for the Gibson Assemblies, NEB® 5-alpha Competent E. coli (High Efficiency) cells were transformed (Protocol 4) with 1 ng pUC19 plasmid DNA. Four colonies were picked the next day, inoculated in selective LB media (100 µg/ml (w/v), and grown overnight. The overnight cultures were used for isolation of plasmid DNA according to Protocol 5. To screen for correct pUC19 transformants, the isolated plasmid DNA was subjected to restriction digestion with EcoRI for linearization (Protocol 6). The gel electrophoresis (Protocol 2) showed the expected size (2686 bp) for three out of four samples (Fig. 4 B).

Creating a larger stock of pUC19:
(Andreas, Lea)

A 100 ml selective culture (100 µg/ml (w/v) ampicillin) was inoculated with one of the positive pUC19 transformants. The next day, the culture was splitted into two 50 ml falcon tubes and plasmid DNA was isolated according to Protocol 7. To confirm the presence of pUC19, the isolated plasmid DNA was digested with EcoRI and HindIII separately (Protocol 6). Gel electrophoresis (Protocol 2) resulted in faint bands that can be seen at the right size for both digests (Fig. 8).

Figure 8: Gel electrophoresis of analytical restriction digestion of pUC19 with EcoRI and HindIII. Gel loaded (from left to right): Benchtop 1 kb ladder - Analytical digest with EcoRI - Analytical digest with HindIII.

Week 5 (24 Aug - 29 Aug)

Objectives:

• Creation of Gibson overhangs for fragment A, B, C, and D with reduced primer concentrations
• Gradient PCR for C and D with lower primer concentrations and varied PCR cycles
• Creation of Gibson overhangs for fragment C with reduced primer concentrations, but more cycles and template DNA
• Creation of Gibson overhangs for fragment F with a robust PCR kit

Creation of Gibson overhangs for fragment A, C, and D with reduced primer concentrations:
(David, Lea)

To eliminate or reduce primer clouds, the PCRs for creation of Gibson overhangs for fragments A, C, and D were repeated. This time, primer concentrations were reduced to ~50 % (0.13 µM) and to ~25 % (0.065 µM) compared to the recommended concentration (0.25 µM) (Protocol 1).
On the one hand, PCR analysis (Fig. 9) (Protocol 2) revealed that for fragment A, a lower primer concentration seems to reduce unspecific bands. On the other hand, for C and D, both primer clouds and the desired bands were reduced with lower primer concentrations. Note: The PCR should have been repeated with the normal primer concentrations to be able to compare the new conditions to the standard one.

Figure 9: Gel electrophoresis of Gibson-Overhang PCR of fragment A, C, and D with different primer concentrations. Gel loaded (from left to right): BenchTop 1kb ladder - A (50% primer) - C (50% primer) - D (50% primer) - A (25% primer) - C (25% primer) - D (25% primer).

Gradient PCR C and D with lower primer concentrations:
(Andreas)

Considering the results of the PCR before, we decided to run a gradient PCR with 25% of the standard primer concentration. The gradient comprised the following annealing temperatures: 63, 64, 65, and 66 °C. Additionally, denaturation time was increased by 10 s, extension time by 15 s, and template DNA was increased to 20 ng, compared to Protocol 1. For fragments C and D, increasing the annealing temperature reduced the intensity of the primer clouds but also of the desired bands (Fig. 10) (Protocol 2).

Figure 10: Gel electrophoresis of Gibson-Overhang PCR of fragment A, C, and D with temperature gradient. Gel loaded (from left to right): BenchTop 1kb ladder - C (63 °C - 66 °C, increasing by 1 °C) - D (63 °C - 66 °C, increasing by 1 °C).

Creation of Gibson overhangs for fragment C with reduced primer concentrations, but more cycles and template:
(Lea, Andreas)

With fragment C, further PCR optimization was attempted with two different cycle numbers (35 and 40), a template DNA increase to 3 µl (= 30 ng), and primer reduction to 20% (~0.05 µM). These conditions were tested for two annealing temperatures (66 °C and 72 °C). Everything else was done according to Protocol 1 and Protocol 2. No interesting difference was recognized (Fig. 11 A), so optimization was abandoned.

Creation of Gibson overhangs for fragment F with a robust PCR kit:
(Lea)

Since we had the most issues with fragment F, we decided to try the Gibson-Overhang PCR with a robust PCR kit (Protocol 8), which is designed to help amplify difficult fragments by facilitating primer binding. Although the robust kit is supposed to work independent of PCR optimization, we immediately set up a gradient PCR for the annealing temperature (60, 61.1, 62.2, and 63.3 °C) as a precautionary measure.
For all temperatures, a band is visible at the right size of ~ 1300 bp, which gets stronger with higher temperatures (Fig. 11 B). As expected, this kit produced many unspecific amplicons, but it allowed us to continue our work with fragment F without having to re-design the primers (Protocol 2).

Figure 11: A: Gel electrophoresis of Gibson-Overhang PCR of fragment C with increased template and cycles at two temperatures. Gel loaded (from left to right): BenchTop 1kb ladder - C (66 °C, 35 cycles) - C (72 °C, 35 cycles) - C (66 °C, 40 cycles).
B: Gel electrophoresis of Gibson-Overhang PCR of fragment F with Protocol 8 and increasing annealing temperatures. Gel loaded (from left to right): BenchTop 1kb ladder - F (60 °C) - F (61.1 °C) - F (62.2 °C) - F (63.3 °C).

Week 6 (31 Aug - 04 Sep)

Objectives:

• Creation of Gibson overhangs for fragment H with reduced primer concentrations
• Gradient PCR for fragments F and D with the robust PCR kit
• Restriction digestion and CIP treatment of pUC19 plasmid
• Creation of Gibson overhangs for fragment B, C, and D with more template, more cycles, or both
• Creation of Gibson overhangs for fragments C and F with greater PCR volumes for subsequent gel extraction

Creation of Gibson overhangs for fragment H with reduced primer concentrations:
(Anirudh, Sophia)

A reduction of the primer concentration to 50% was attempted for fragment H (Protocol 1), but it led to very faint bands (Protocol 2). This was most likely explained by a procedural mistake with gel electrophoresis, as fragment A, which was repeated with 25% primer concentration, was also extremely faint (compared to Fig. 11).

Gradient PCR for fragments F and D with the robust PCR Kit:
(Lea)

After the PCR Protocol 8 yielded the desired band for fragment F and a rising annealing temperature was accompanied by a rising band intensity, the gradient PCR was continued with higher temperatures (64.9, 66.6, 68.2, and 69.7 °C). In addition, amplification of fragment D was also attempted with Protocol 8 for the temperatures 62, 63.3, 66.6, and 68.8 °C.

Gel electrophoresis (Protocol 2) showed that PCR with Protocol 8 worked for D as well, however, rising annealing temperatures lead to fainter bands (Fig. 12 A). For fragment F, higher temperatures did not improve the PCR yield any further (Fig. 12 B).

Figure 12: Gel electrophoresis of Gibson-Overhang PCR of fragment D and F with the AllTaq PCR Kit and increasing annealing temperatures. A: Gel loaded (from left to right): BenchTop 1kb ladder - D (62 °C) - D (63.3 °C) - D (66.6 °C) - D (68.8 °C).
B:Gel loaded (from left to right): GeneRuler 1kb ladder - F (64.9 °C) - F (66.6 °C) - F (68.2 °C) - F (69.7 °C)

Restriction digestion and CIP treatment of pUC19 plasmid:
(Lea, Anirudh)

With progress in PCR optimization and getting closer to Gibson Assembly, the next step was to prepare our vector backbone. Therefore, pUC19 DNA (Maxiprep) was digested with both RE EcoRI and HindIII to linearize the plasmid and produce the necessary overhangs for the assembly. Additionally, it was treated with NEB Quick CIP (calf-intestinal alkaline phosphatase) to prevent re-ligation of linearized plasmid DNA (Protocol 9).

Creation of Gibson overhangs for fragments B, C, and D with more template, more cycles, or both:
(Florian, David)

We concluded that the unspecific amplicons would have to be excluded through gel extraction of our specific amplicon DNA. To produce a higher amplicon yield for gel extraction and in general for having more DNA for Gibson Assembly reactions, we tried playing with other PCR parameters. We added more template DNA (25 ng instead of 10 ng), ran PCR for more cycles (40 vs. 35), or the combination of both. Everything else was done according to Protocol 1. This was done for fragment B1, B2, C, and D. In the gel analysis (Protocol 2), we could not really compare the different conditions, as hardly any bands were visible.

Figure 13: B: Gel electrophoresis (Protocol 2) of Gibson-Overhang PCR of fragment B1, B2, C, and D with different template concentrations and number of cycles. Gel loaded (from left to right): BenchTop 1kb ladder - B1 - B2 - C - D (25 ng template, 35 cycles) - B1 - B2 - C - D (10 ng, 40 cycles) - B1 - B2 - C - D (25 ng, 40 cycles) - BenchTop 1kb ladder

Creation of Gibson overhangs for fragment C and F with greater PCR volumes for subsequent gel extraction:
(Aaron, David)

Since we repeatedly observed an unspecific band at 750 bp for many of our fragments, and primer clouds seemed to prevail, we decided to upscale our PCRs and perform gel extraction of the specific DNA loaded on the agarose gel. The same procedure was done with fragment F, since it only worked with the robust PCR method (Protocol 8), which produces many unspecific amplicons. This was first done with fragment C and fragment F, where the 200 µl reaction mix was split into 2 x 100µl for a more precise temperature transmission during PCR. Fig. 14 A (Protocol 2) shows that F1 didn’t work, but unfortunately F1 and F2 were already pooled back together for gel extraction. Gel extraction (Protocol 10) of F and C was very successful (Week 7), decreasing the unspecific bands substantially (Fig. 14 B). Note: for the gels of Fig. 14 A/B, we had already changed the DNA stain from SYBR® Gold DNA Stain to SYBR® Safe DNA Stain, as the former one was old and ineffective. With SYBR® Safe, we performed precast staining as opposed to incubating gels in stain baths as we did for SYBR® Gold.

Figure 14: A: Gel electrophoresis of Gibson-Overhang PCR of fragment C with Protocol 1 and fragment F with Protocol 8. Gel loaded (from left to right): BenchTop 1kb ladder - C(1) - C(2) - F(1) - F(2)
B: Gel electrophoresis of Fragments C and F after Gel extraction and purification. Gel loaded (from left to right): GeneRuler 1kb ladder - F (extracted, purified) - C (extracted, purified).

Week 7 (07 Sep - 11 Sep)

From this week forward, we used SYBR® Safe DNA Stain and only did precast staining, unless specified otherwise. This change highly improved the quality of our gel images and saved us the 30 minutes required for the bath staining with SYBR® Gold DNA Stain, which was also old and therefore ineffective.

Objectives:

• Gel extraction of fragments C and F
• Creation of Gibson overhangs for fragments A and H
• Gel extraction of fragments B1, B2, and D
• Creation of Gibson overhangs for fragment E
• Double restriction digestion and CIP treatment pUC19 plasmid
• Gibson Assemblies GA1, GA1(1:4), GA3, GA5, GA5(1:4), and GA6
• Creation of Gibson overhangs for fragments A, B1, C, and F, and gel extraction

Gel extraction of fragments C and F:
(Andreas, Lea)

For gel extraction (Protocol 10), both 100 µl PCR set ups were pooled back together and were then purified and eluted in only 15 µl (Protocol 3) to be able to load all of the DNA together. After extraction, the samples were additionally purified and eluted in 10 µl (Protocol 3). Both fragments then showed clear, bright bands in the gel (Fig. 14 B, Week 6) (Protocol 2).

Creation of Gibson overhangs for fragments A and H:
(Andreas)

Fragments A and H did not show any unspecific bands, therefore, their total PCR reaction volumes were only increased to 50 µl (2 x 25 µl each) (Protocol 1) and then purified and eluted in 10 µl (Protocol 3). For fragment A, only 25 % primer concentration was used (compared to standard), as this modification had previously shown good results (Fig. 12). Clear specific bands were visible for both fragments with no noticeable unspecific bands (Fig. 15).

Figure 15: Gel electrophoresis of Gibson-Overhang PCR of fragments A and H after purification. Gel loaded (from left to right): GeneRuler 1kb ladder - A(1) - A(2) - H(1) - H(2).

Gel extraction of fragments B1, B2, and D:
(Florian, Lea, David)

For fragments B1, B2, and D, 100 µl or 200 µl Gibson-Overhang PCR reactions (Protocol 1) were concentrated to 15 µl (Protocol 3) and then loaded onto a gel for gel extraction (Protocol 10). Isolation of the specific bands for B1, B2, and D was successful (Fig. 16 A and B) (Protocol 2).

Creation of Gibson overhangs for fragment E:
(Aaron, Lea)

Fragment E didn’t show unspecific bands or big primer clouds and therefore a 200 µl PCR reaction was performed (Protocol 1) and the product was purified into 10 µl (Protocol 3). Unexpectedly, an unspecific band for E appeared at 1000 bp (Fig. 16 B). This can be explained by the high amount of DNA resulting from the large PCR reaction volume. Since the unspecific band was very faint, the sample was still used for the Gibson Assemblies.

Figure 16: A: Gel electrophoresis of Gibson-Overhang PCR of fragment B1 and D after gel extraction and purification. Additionally, new Bs was created. Gel loaded (from left to right): BenchTop 1kb ladder - Bs - B1 - D. B: Gel electrophoresis of fragment E after purification and fragments B2 after Gel extraction and purification. Gel loaded (from left to right): BenchTop 1kb ladder - B2 - E.

Double restriction digestion and CIP treatment pUC19 plasmid:
(Lea, David)

Unfortunately, concentration of the first double-digested (i.e. with two restriction enzymes) and CIP treated pUC19 DNA was really low, so the process was repeated (Protocol 9). Again, the yield was too low. To achieve a higher concentration, both samples were pooled together and concentrated into 10 µl (Protocol 3), resulting in a concentration of ~50 ng/µl (ideal for a Gibson Assembly reaction, where 50 ng of vector backbone DNA suffices).

Gibson Assemblies GA1, GA1(1:4), GA3, GA5, GA5(1:4), and GA6:
(Lea, David)

Having several fragments ready for Gibson Assembly, the assemblies GA1, GA3, GA5, and GA6 were attempted (Table 2). Gibson Assembly was done according to Protocol 11 and chemically competent cells were transformed with the resulting GA1, GA1(1:4), GA3, and GA6 reaction products (Protocol 4). A 25 µl aliquot of competent cells was transformed with half (5 µl) of the assembly reaction. For the assemblies described as “(1:4)”, half (5 µl) of an assembly reaction were diluted 1:4 to 20 µl, and 5 µl of this dilution were used for transformation. Unfortunately, plates with GA3 did not show colonies the next day.

Table 2: Overview Gibson Assemblies

Assembly name	Fragments		Primers
GA1	E	Mn-Promoter - Mn-Riboswitch	13+14
	F	FAST - Chromoprotein - Terminator	15+16
GA2	E	Mn-Promoter - Mn-Riboswitch	13+14
	G	FAST - Phytochelatine- Terminator	15+16
GA3	H	Anderson-Promoter - Mn Riboswitch	11+12
	F	FAST - Chromoprotein - Terminator	15+16
GA4	H	Anderson-Promoter - Mn Riboswitch	11+12
	G	FAST - Phytochelatine- Terminator	15+16
GA5	A	Anderson-Promoter - B12 Riboswitch	7+8
	B1	Tet-Inverter-System	4+5
	C	GFP-Terminator	1+2
GA6	A	Anderson-Promoter - B12 Riboswitch	7+8
	B2	Tet-Inverter-System	10+6
	D	mRFP-Terminator	3+9

Creation of Gibson overhangs for fragments A, B1, C, and F, and gel extraction:
(Aaron, Florian, David)

To ensure continuous repetition of failed Gibson Assemblies, more PCRs were performed. Two 100 µl PCRs for fragment F were done according to Protocol 8. For fragments A, B1, and C, 100 µl (2 x 50 µl or 100 µl) PCRs were done according to Protocol 1, but with 3 µl DNA template (= 30 ng) per 25 µl of reaction mix to try to increase yield. After verifying that the PCRs had worked (Fig. 17) (Protocol 2), the PCR reactions were pooled respectively and then purified (Protocol 3). As A(1) and A(2) only showed the desired specific band on the gel, the DNA was eluted in 30 µl and then stored. The other PCR products displayed unspecific bands on the gel, so gel extraction was necessary. After DNA elution in 15 µl, this was performed according to Protocol 10.

Figure 17: Gel electrophoresis of Gibson-Overhang PCR of fragments A and H after purification. Gel loaded (from left to right): BenchTop 1kb ladder - A(1) - A(2) - B1 - C(1) - C(2) - F(1) - F(2).

Week 8 (14 Sep - 18 Sep)

Objectives:

• Colony PCR of GA1, GA1(1:4), and GA6
• Double restriction digestion and CIP treatment of pUC19 plasmid DNA
• Plasmid DNA isolation of promising GA1 and GA1(1:4) transformants and subsequent analytical restriction digestion
• Isolation of pUC19 plasmid DNA and subsequent analytical restriction digestion
• Transformation with GA5 and GA5(1:4) and colony PCR
• Creation of Gibson overhangs for fragment H and new Bs

Colony PCR of GA1, GA1(1:4), and GA6:
(Benedikt, Luise)

Colony PCR was performed to assess which Gibson Assemblies and transformations worked (Protocol 12). PCR analysis of GA1 (Fig. 18 and Fig. 19 A) (Protocol 2) revealed that colonies 12 and 13 from GA1 contained an insert, and the insert size of colony 13 corresponded to ca. 1800 bp, the desired size. Unfortunately, GA6 didn’t show any specific bands (Fig. 19 B). For GA1(1:4), colonies 12, 13, 14, 16, 18, and 19 showed correct insert sizes (Fig. 20), indicating that dilution of the reaction before transformation had had an effect in the efficiency, presumably due to the decrease in reaction components. The colonies with bands below 250 bp are presumably transformants of undigested pUC19, as digestion is never 100 % efficient.

Figure 18: Gel electrophoresis of colony PCR from GA1. pUC19 is a negative control, where only the empty digested plasmid was transformed. Samples 12 and 13 are labelled, as these were the only ones showing insert amplification.

Figure 19: Gel electrophoresis of colony PCR from GA1 (A) and GA6 (B). pUC19 is a negative control, where only the empty plasmid was transformed.

Figure 20: Gel electrophoresis of colony PCR from GA1(1:4). Only the colonies with the right insert size are labelled.

Double restriction digestion and CIP treatment of pUC19 plasmid DNA:
(Aaron)

With previous low concentrations for double-digested and CIP treated pUC19, we were in need of more and repeated this step with 2.6 µg DNA (Protocol 9).

Plasmid DNA isolation of promising GA1 and GA1(1:4) transformants and subsequent analytical restriction digestion:
(Lea)

Colonies from the corresponding samples were inoculated in selective media (100 µg/ml ampicillin sodium salt) for overnight growth. The next day, plasmid DNA was isolated (Protocol 5). Concentrations are given in Table 3.

- GA1: samples 12 and 13
- GA1(1:4): samples 12, 13, 14, 16, 18, and 19

Table 3: Plasmid DNA concentrations of promising GA1 and GA1 (1:4) transformants.

Sample	Concentration (ng/µl)
GA1 (1:4) 12	373.6
GA1 (1:4) 13	477.1
GA1 (1:4) 14	307.9
GA1 (1:4) 16	341.3
GA1 (1:4) 18	408.7
GA1 (1:4) 19	391.3
GA1 12	423.4
GA1 13	466.2

Isolated plasmid DNA was digested once with EcoRI and once with HindIII (Protocol 6) and the linearized plasmid DNA was then analyzed via gel electrophoresis (Protocol 2). Plasmid DNA was observed at the correct size (ca. 4300 bp). However, HindIII seemed to produce an extra gel band, presumably nicked DNA since the enzyme was old and the extra band is positioned above the specific band (Fig. 21 A and B) (Protocol 2).

Isolation of pUC19 plasmid DNA and subsequent analytical restriction digestion:
(Lea, Andreas)

After inoculation of pUC19-containing E. coli in 5 x 20 ml selective medium (100 µg/ml ampicillin sodium salt) and overnight growth, plasmid DNA was isolated (Protocol 7). This time, a high concentration of 373.1 ng/µl was achieved for a total of 200 µl. The plasmid DNA was digested with EcoRI and HindIII separately (Protocol 6) and the gel analysis (Fig. 21 B) (Protocol 2) confirmed pUC19 with bands at 2686 bp.

Figure 21: Gel electrophoresis restrictions digest with EcoRI and HindIII for GA1 sample 12 and 13 and GA1(1:4) samples 12, 13, 14, 16, 18, 19 and pUC19 plasmid from Maxi-Prep. A: Gel loaded (from left to right): BenchTop 1kb ladder - GA1 sample 13, EcoRI - GA1(1:4) sample 13, 14, 16, 18, 19 with EcoRI - BenchTop 1kb ladder - GA1 sample 13, HindIII - GA1(1:4) sample 13, 14, 16, 18, 19 with HindIII
B: Gel loaded (from left to right): BenchTop 1kb ladder - GA1 sample 12, EcoRI - GA1 sample 12, HindIII - GA1(1:4) sample 12, EcoRI - GA1(1:4) sample 12, HindIII - pUC19 EcoRÎ - pUC19 HindIII.

Transformation with GA5 and GA5(1:4) and colony PCR:
(Andreas, Lea)

GA5 and GA5(1:4) were transformed into E. coli (Protocol 4) and subjected to colony PCR the next day (Protocol 12). Gel analysis (Fig. 22) (Protocol 2) revealed insertion of fragment A (530 bp including overhangs) in many samples. In later Gibson Assemblies, the molar ratio of fragment A was relatively reduced.

Figure 22: Gel electrophoresis of colony PCR from GA5 and GA5 (1:4). Bands right above 500 bp represent fragment A insertions.

Creation of Gibson overhangs for fragment H and new Bs:
(Aaron, Lea)

PCR for Gibson overhangs was performed for fragment H along with a PCR to remove IDT base pairs from fragment B (Protocol 1). Afterwards, the samples were purified and concentrated to 20µl (Bs) and 15µl (H) (Protocol 3).

Week 9 (21 Sep - 25 Sep)

Objectives:

• Resuspension of fragment G
• Creation of Gibson overhangs for fragments G and B2
• Creation of Gibson overhangs for fragment F
• Gel extraction of fragments B2, G, and F
• Gibson Assemblies GA2, GA3, and GA4

Resuspension of fragment G:
(Florian)

Fragment G finally arrived and was dissolved with nuclease-free water to a concentration of 10 ng/µl.

Creation of Gibson overhangs for fragments G and B2:
(Florian)

The newly arrived fragment G was tested with both PCR protocols (Protocol 1 and Protocol 8). Additionally, a 100 µl Gibson overhang PCR for fragment B2 was done (Protocol 1). PCR analysis (Protocol 2) revealed that fragment G could be amplified correctly with both protocols (Fig. 23 A). Since the DNA polymerase used in Protocol 1 has a higher fidelity, the Protocol 1 was then used for a 100µl PCR of fragment G.

Creation of Gibson overhangs for fragment F:
(Florian)

Two 100µl PCRs for Gibson overhangs on fragment F were done according to Protocol 8 and gel analysis (Protocol 2) confirmed it worked (Fig. 23 B).

Gel extraction of fragments B2, G, and F:
(Andreas)

All PCR products were concentrated first to 15 µl (B2, G) or 20 µl (combined F samples) (Protocol 3) and then gel extracted (Protocol 10). Through gel extraction, the unspecific bands of fragment F were excluded. For fragment G, an unspecific but very faint band is visible at around 1400 bp (Fig. 23 C) (Protocol 2).

Figure 23: A: Gel electrophoresis of Gibson-Overhang PCR of fragments G and B2. Gel loaded (from left to right): BenchTop 1kb ladder - B2(Protocol 1) - G(Protocol 1) - G(Protocol 8) - BenchTop 1kb ladder
B: Gel electrophoresis of Gibson-Overhang PCR of fragment F. Gel loaded (from left to right): BenchTop 1kb ladder - F(1) - F(2)
C: Gel electrophoresis of fragment B2, G, and F after gel extraction and purification. Gel loaded (from left to right): BenchTop 1kb ladder - B2 (extracted, purified) - F (extracted, purified) - G (extracted, purified)

Gibson Assemblies GA2, GA3, and GA4:
(Florian)

GA2 and GA4 were performed for the first time and GA3 was repeated (Protocol 11). Since GA1 had worked (F+E) and GA3 (F+H) had not, the molar ratio of H was increased to 5:1 (insert:backbone) as the common denominator was F. E. coli was subsequently transformed (Protocol 4). After overnight growth, all plates showed colonies.

Week 10 (28 Sep - 02 Oct)

Objectives:

• Colony PCR of GA2, GA3, and GA4
• Sequencing of positive clones from GA1, GA2, GA3, and GA4

Colony PCR of GA2, GA3, and GA4:
(Luise, David, Andreas)

To assess which Gibson Assemblies and transformations worked, colony PCR was performed for ca. 20 colonies per GA (Protocol 12). Analysis of PCR products by gel electrophoresis (Protocol 2) revealed multiple potential clones for all assemblies (Fig. 24). Approximately five clones were inoculated for isolation of their plasmid DNA (Protocol 5) and subsequent Sanger sequencing (Microsynth service).

Figure 24: Gel electrophoresis of colony PCR from GA2, GA3, and GA4. Positive samples for GA3 are marked with arrows. For all other GA there were several positive samples. Approximate desired band/insert sizes: 1200 bp for GA2, 1600 bp for GA3, and 1000 bp for GA4.

Sequencing of positive clones from GA1, GA2, GA3, and GA4:
(Andreas, Aaron, Luise)

To verify the sequence of the inserts, isolated plasmid DNA was prepared for the Sanger sequencing service by Microsynth (Balgach). For this, specific M13 primers offered by Microsynth were selected to amplify the insert region within the pUC19 vector. After alignment analysis with SnapGene (GSL Biotech, California), one clone containing an intact insert sequence was chosen for the measurement experiments for each GA (four clones in total). We quickly noticed a mistake in our sequence: A PstI restriction site which is incompatible with the iGEM standards BioBrick RFC[10] and Type IIS RFC[1000] (Fig. 25). We had ordered the wrong sequences, so we decided to design and order primers for site-directed mutagenesis (SDM) (Table 4) as well as the initially designed FAST2 sequences (of F and G) that did not contain the PstI (silent mutation of leucine codon from CTG to CTT) for repetition of Gibson Assemblies (Fig. 26). We placed different orders for the SDM primers and the corrected fragments F and G and decided to execute the first available method. Furthermore, we noticed that due to the larger insert sizes of GA1 and GA3, the first few dozen base pairs downstream of the sequencing primers were not covered by the sequencing. To complete sequencing of the insert borders, we designed sequencing primers annealing in the FAST2 sequence according to the Microsynth requirements (Fig. 26) (Table 4).

Figure 25: Alignment of Sanger sequencing results of GA1 with hypothetical reference sequence (SnapGene). The sequence aligns perfectly with our old sequence containing the illegal PstI restriction site.

Figure 26: FAST2 sequence indicating location of SDM primers Pst_fix_RV/FW and sequencing primers FAST_mid_RV/FW. The SDM primers partially overlap, creating nicked plasmid DNA during PCR which is re-ligated in the host cell after transformation. The sequencing primers completely overlap with each other, but are used in separate reactions for sequencing.

Table 4: Primers for SDM and for complete sequencing of GA1 and GA3

Primer name	Sequence (5' --> 3')
Pst_fix_RV	ttgtactgaaggatattcccgtcaccatcgag
Pst_fix_FW	ggaatatccttcagtacaatgctgctgaaggagac
FAST_mid_RV	ctgcttgtcggtatcatcc
FAST_mid_FW	ggatgataccgacaagcag

Week 11 (05 Oct - 09 Oct)

Objectives:

• GA5 and GA6 with increased B1/2 and C concentrations and subsequent colony PCR
• Plasmid DNA isolation and analytical restriction digestion of interesting GA5 and GA6 samples
• Streak plates for all four GA1-4 clones and a pUC19 clone for sub-cultivation

GA5 and GA6 with increased B1/2 and C concentrations and subsequent colony PCR:
(Andreas)

Since only insertion of fragment A was observed in GA5 and GA6 (Fig. 22), the assemblies were repeated (Table 2) (Protocol 11). This time, fragments B1/2 and C were added to a molar ratio of 5:1 (insert : backbone). The finished reactions were used for transformation of E. coli (Protocol 4). The next day, colonies were picked for colony PCR (Protocol 12), however, no correct bands were observed on the gel (Protocol 2). The expected insert size is approximately 2300 bp for both GAs, and only unspecific bands were visible (Fig. 27).

Figure 27: Colony PCR of GA5 and GA6. Only unspecific bands are visible between 2500-3000 bp, 1500-2000 bp (presumably B + C insertion), and 500-750 bp (presumably A insertion). The red arrows point at samples that were analyzed further.

Plasmid DNA isolation and analytical restriction digestion of interesting GA5 and GA6 samples:
(Andreas)

Eight interesting samples of GA5 and GA6 (Fig. 27) were analyzed further. For this, plasmid DNA was isolated (Protocol 5) and subsequently digested with EcoRI (Protocol 6). As a control, plasmid DNA of GA2-4 sequenced clones was digested the same way. The plasmid DNA isolated from the interesting GA5 and GA6 clones was smaller than the desired size of ca. 4900 bp (Fig. 28).

Figure 28: Analytical restriction digestion of plasmid DNA isolated from interesting GA5 and GA5 clones. The plasmid DNA of GA5 and GA6 clones is under the desired size of ca. 4900 bp. The controls, GA2, GA3, and GA4, show the correct band sizes.

Streak plates for all four GA1-4 clones and a pUC19 clone for sub-cultivation:
(Andreas)

The chosen sequenced GA1-4 clones and a pUC19 clone were streaked on non-selective LB agar plates to commence a sub-cultivation experiment with non-selective media. This experiment was designed to assess transgenerational propagation stability of our constructs without selective pressure.

Week 12 (12 Oct - 18 Oct)

Objectives:

• Assembly of correct GA1, GA2, GA3, and GA4
• Colony PCR of correct GA1, GA2, GA3, and GA4
• Sequencing of correct GA1, GA2, GA3, and GA4 clones
• Continuing stability test

Assembly of correct GA1, GA2, GA3, and GA4:
(Andreas, Florian, Luise)

Since the site-directed mutagenesis primers arrived at the same time as the correct fragments F and G, we chose to repeat Gibson Assembly with the new fragments, the more reliable option considering we had optimized the procedure. After PCR of F (Protocol 8) and G (Protocol 1) for addition of Gibson overhangs, the amplified DNA was concentrated (Protocol 3), loaded on a gel, and extracted (Protocol 10). After concentration measurements, the Gibson Assemblies of GA1, GA2, GA3, and GA4 were repeated with the correct versions of F and G (no PstI restriction site) (Protocol 11). The assembly reactions were used to transform E. coli (Protocol 4).

Colony PCR of correct GA1, GA2, GA3, and GA4:
(Anirudh, Isabel)

All GA1-4 plates had hundreds of colonies on them (Fig. 29). Dozens of colonies were picked for each GA and subjected to colony PCR (Protocol 12). The efficiency was very high, with most colonies giving positive signals on the gel (Fig. 29) (Protocol 2).

Figure 29: Colony PCR of correct GA1, GA2, GA3, and GA4. Correct bands: ca. 1800 bp (GA1), ca. 1200 bp (GA2), ca. 1600 bp (GA3), and ca. 1000 bp (GA4). Cell material of the old GA1-4 sequenced clones was used for PCR and gel electrophoresis control (positive). The negative control was the PCR master mix without template DNA. Only 9 out of 76 test samples were incorrect.

Sequencing of correct GA1, GA2, GA3, and GA4 clones:
(Luise, Anirudh, Andreas, Isabel)

After confirmation of successful assembly and transformation (Fig. 29), plasmid DNA was isolated (Protocol 5) from multiple clones for each GA and sent for Sanger sequencing by Microsynth to inspect the insert sequences. Mutation-less clones were found for each GA (Fig. 30).

Figure 30: Alignment of Sanger sequencing results of GA1 wth hypothetical reference sequence as an example of an intact insert sequence (SnapGene). Microsynth standard primers M13-40 (forward), M13-r (reverse), and in-house primers FAST_mid_FW and FAST_mid_RV were used for the Sanger sequencing reaction of GA1 and GA3. For GA2 and GA4, only the Microsynth M13 primers were used due to the smaller size of the insert sequence. A point mutation is visible in the PstI restriction site, indicating that the restriction site is no longer present in the new FAST2 sequences.

Fluorescence measurement:
(Luise, Isabel, Anirudh, Andreas)

To test the functionality of our constructs, fluorescence was measured (3 experimental replications, 3 sample replications for each experiment) (Protocol 13). For this, we tested different manganese(II) chloride concentrations and used sequenced clones from the old GA1-4 and the new (corrected) GA1-4, as well as a pUC19 clone as a control. Unfortunately, the 2020 iGEM measurement kit was not available, and our 2018 version was non-functional. Therefore, our plate reader was not calibrated. Furthermore, fluorescence values, although measured at similar cell densities, were random and independent of manganese concentrations (Fig. 31).

Figure 31: Fluorescence intensity (y-axis) measured at an OD600 of ca. 0.9 for different manganese concentrations (A, B, and C) and constructs (x-axis). The values are random and no pattern is identifiable.

Continuing stability test:
(Anirudh)

The propagation stability test for the old constructs GA1-4 was continued throughout the week by transferring cell material to new non-selective LB agar plates every other day.

Week 13 (19 Oct - 23 Oct)

Objectives:

• Chromoprotein experiment
• Fluorescence microscopy
• mRNA experiment
• Analyzing stability test

Chromoprotein experiment:
(Anirudh, Andreas)

Since the results obtained from fluorescence measurement with the plate reader were inconclusive (Fig. 31), we decided to qualitatively test the expression of the blue chromoprotein of GA1 and GA3. For this, selective LB agar plates (100 µg/ml ampicillin sodium salt) were prepared with 3 different manganese(II) chloride concentrations (0, 10, and 20 µM). A sequenced clone for each GA (old and new versions) and a pUC19 clone were streaked on the plate and grown overnight. No color changes (i.e. no blue colonies) were observed (Fig. 32).

Figure 32: Chromoprotein experiment plates. Three selective LB agar plates (100 µg/ml ampicillin sodium salt) containing three different manganese(II) chloride concentrations - 0 µM (A), 10 µM (B), and 20 µM (C) - were prepared and a clone for GA1 and GA3 (old and new/corrected versions) was streaked. No blue color is visible on the cells.

Fluorescence microscopy:
(Isabel, Luise)

As a final qualitative test for the functionality of our constructs, GA2 (new/corrected version) and pUC19 (control) cells were visualized under the fluorescence microscope after growth in selective media (100 µg/ml ampicillin sodium salt) with 10 µM manganese(II) chloride and incubation in a fluorogen-labeling solution (see Protocol 13 for details on labeling). The same autofluorescence was observed for the pUC19 and GA2 clones (Fig. 33).

Figure 33: Live cell imaging of GA2 (corrected version) and pUC19 cells under the fluorescence microscope. Laser settings: Wavelengths 485 nm (absorbance) and 535 nm (emission). 1.5 x 630 zoom. (A) pUC19 control, growth in 10 µM Manganese. (B) GA2 (corrected version), growth in 10 µM Manganese.

mRNA experiment:
(Luise, Anirudh, Andreas)

The failure to produce fluorescence (Fig. 31 and Fig. 33) or a visible blue color (Fig. 32) with our GA1-4 clones (old and corrected versions) made us take a closer look at our sequences again. We noticed the absence of a ribosome binding site (RBS) between our riboswitch sequences and the phytochelatin/chromoprotein gene. The mistake in our design was caused by the misconception that the riboswitch sequence available in the parts registry would include an RBS downstream of the riboswitch. With only two days left for wet lab work, we quickly designed a Reverse Transcriptase (RT)-PCR experiment (Protocol 14) to investigate mRNA synthesis and validate our promoters, which function independently of an RBS.

Unfortunately, the experiment was inconclusive. We expected an amplicon of ca. 320 bp and a difference in signal intensity between growth with 0 µM and 10 µM manganese(II) chloride for constructs with manganese-inducible promoters, however, the negative controls had the same band sizes and different manganese concentrations did not produce different signal intensities. Although the band sizes of the negative controls seem to be slightly larger, this could be explained by a variable gel morphology. Interestingly, all negative controls have similar bands to the AllTaq PCR Master Mix negative control, which did not contain template cDNA (Fig. 34) (Protocol 2).

Figure 34: Gel electrophoresis of cDNA amplification via PCR. The desired band size was ca. 320 bp. Test samples include the old GA1-4 and the corrected GA2 and GA3 clones. Negative controls include the pUC19 samples, the reverse transcription (RT) reaction mix, and the AllTaq PCR master mix without template cDNA.

Analyzing stability test:
(Anirudh, Andreas)

To finalize the wet lab experience, we analyzed our plasmid stability test by transferring cell material from each clone to a selective lb agar plate (100 µg/ml ampicillin sodium salt) and performing colony PCR (Protocol 12) after overnight growth. In total, nine transfers were made (Fig. 35). All clones grew when transferred back to selective media (Fig. 36). Correct signals were obtained for all tested clones in colony PCR (Fig. 37) (Protocol 2).

Figure 35: Non-selective LB agar plates containing the old GA1, GA2, GA3, and GA4 clones, and a pUC19 clone, used for the stability test.

Figure 36: Final selective plate from which colonies of the old GA1, GA2, GA3, and GA4 constructs were picked for colony PCR.

Figure 37: Colony PCR of stability test. A correct band is observable for all GA clones (very faint for GA1 and GA3, marked with red arrows). The controls show the expected band sizes.

---

---

---