Team:UFlorida/Contribution
Contributions
Contribution #1: Insulator Sequence
To increase the expression of part BBa_K1139201 designed by iGem Tokyo 2013 Team, and sfGFP proteins of future iGEM projects, the RiboJ insulator sequence can be added between the pPhoA promoter and the downstream sequences. Insulators protect against unexpected interactions between neighboring sequences in a genetic circuit (Clifton 2). A common insulator, RiboJ, is made up of the sTRSV-ribozyme, along with a subsequent 23-nucleotide hairpin sequence (Luo 3). The hairpin structure helps expose the ribosome binding site, so that translation can be increased for the downstream sequence transcripts (Luo 3). Therefore, insulators, and specifically, the RiboJ sequence, can be used to increase the efficacy of gene and protein expression in future experimental genetic constructs. The part would look like this
The results from the Department of Biology at the College of William and Mary show greater absolute sfGFP fluorescence was observed in the promoter construct insulated with the RiboJ sequence, as compared to the promoter without RiboJ insulation (Clifton 4). It was determined from this experiment that using a RiboJ insulator within the composite part construct leads to increased sfGFP protein expression and higher concentration of mRNA transcripts (Clifton 4).
Figure 1. Each dot represents the average fluorescence value of a sample size greater than 10,000 cells. The blue dots represent the absolute fluorescence of the construct including the RiboJ insulator, while the black dots represent the absolute fluorescence of the construct without the RiboJ sequence. The x-axis is labeled with the names of the BioBrick constructs used in this experiment. As seen in the graph from the Journal of Biological Engineering, RiboJ insulator increased the expression of sfGFP protein, which resulted in greater mean absolute fluorescence values for each BioBrick construct (Clifton 4).
Figure 2. This experiment by Clifton, Jones, et al., compared the protein expression levels of 24 constitutive promoters, some of which contained the RiboJ insulator sequence and others that did not. The only difference between a promoter and its paired construct was the presence of added RiboJ insulator sequence. As seen in the graph on the right, as published in the Journal of Biological Engineering, the blue column represents the constitutive promoters that included the RiboJ sequence, while the gray column represents the promoters without the addition of RiboJ (Clifton). When comparing the mRNA and protein expression of these promoters, it was determined in the Journal of Biological Engineering that RiboJ insulators increase the expression levels of the constructs (Clifton).
RiboJ insulator DNA sequence (Meyer 4): AGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGCCTCTACAAATAATTTTGTTTAA
Including the DNA sequence (listed above) between the pPhoA and the subsequent genes in Part BBa_K1139201 can increase the expression of sfGFP protein in this specific part, but also in future iGEM experiments that involve the quantification of absolute fluorescence as the output of an experimental design.
Contribution #2: Ribosome Binding Site
To increase the expression of Part BBa_C0040 designed by the Baltimore Biocrew 2017 iGem Team, a ribosome binding site can be added within the Tetr genetic sequence. Ribosome binding sites can be experimentally mutated to improve the protein expression of a genetic circuit in bacteria (Salis 2). The Salis and Voigt lab designed a predictive algorithm to model a DNA sequence that can be introduced into a genetic circuit and optimize the ribosome binding and subsequent translation rates (Salis 2). The lab observed the thermodynamic changes in the RNA folding process and used the resulting energy change values to model the sequences (Salis 2). Because the initiation phase, including ribosome binding, of translation is the rate-determining step, synthetically designing the most thermodynamically-favored RBS sequence will improve and speed up the translation rate for the system.
Tetr RBS DNA Sequence from E. coli genome (Meyer 5): GGAAGAGAGTCAATTCAGGGTGGTGAAT
Tetr RBS DNA Sequence as determined by the RBS calculator (Meyer 5): GTAATAATCCAGGAGGAAAAAA
References
Clifton, K., Jones, E., Paudel, S., Marken, J., Monette, C., Halleran, A., et al. (2018). The genetic insulator RiboJ increases expression of insulated genes. Journal of Biological Engineering. 12(23). doi: 10.1186/s13036-018-0115-6.
Luo, C., Stanton, B., Chen, Y., Munsky, B. and Voight, C. (2012). Ribozyme-based insulator parts buffer synthetic circuits from genetic context. Nat Biotechnol. 30(11): 1137-1142.
Meyer, A., Segall-Shapiro, T., Glassey E., Zhang, J. and Voigt, C. (2019). Escherichia coli “Marionnette” strains with 12 highly optimized small-molecule sensors. Nature Chemical Biology. 15:196-204.
Salis, H., Mirsky, E. and Voigt, C. (2009). Automated design of synthetic ribosome binding sites to precisely control protein expression. Nat Biotechnology. 27(10): 946-950.