Part Improvement
For achieving the gold medal, we have improved the polyphosphate kinase from E. coli strain K12 which is registered in the iGEM Registry as BBa_K1807002. The improved part can be found here. We added specific vacuolar import peptides for Physcomitrella patens and planned to compare the polyphosphate gain in both, the vacuole and the cytosol, where the protein is regularly expressed. The translocation of the protein allows a broad number of applications and is therefore truly an improvement.
Reasons
In our project development, multiple concepts to accumulate phosphate were discussed. During our research phase, we found some information which indicated a toxicity of polyphosphate in the cytosol of plants due to Mg2+ starvation (Rudat et al, 2018). In order to reach a maximum polyphosphate concentration without exceeding toxic limits, we looked for other compartments and chose the vacuole as a possible alternative.
The improvement
For optimal targeting of proteins to specific cell compartments,we decided to work with protein sequence for vacuolar import peptides in P. patens, based on the studies of Schaaf et al from 2004 . This sequence consists of the two parts, the plant specific insert and a specific signal peptide (Schaaf et al, 2004), which are responsible for protein import through the tonoplast into the vacuole. We translated the sequence into a nucleotide sequence using a codon usage table for P. patens , reduced the sequence of the biobrick to the coding part of the protein and added another promoter, ribosomal binding site and terminator for a better application in our model organism. We used the highly efficient promoter I2-10 provided by Henrik Toft Simonson from the Technical University of Denmark, followed by a ribosomal binding site for P. patens. The first part of the import sequence was placed between the ribosomal binding site and the N-terminus of the coding sequence and the second part at the C-terminus of the coding sequencing in front of the terminator. In addition, we moved the stop codon of the coding sequence behind the second part of the import peptide.
Plant specific insert:
5’GTGTCTCAGCAGTGCAAGATGGTGGTGCAGCAGTACGGAGATNNNATCGTGGAGATGTTGTTGGCTCAGATGAACCCTGG
AAAGGTGTGCACTACTTTGGGATTGTGCAACTTCGGAGCTGGAGAGCCTGGAATCGCTTCTGTGGTGGAGAAGGATCAG 3’
Signal peptide:
5’ATGGGAGCTTCTAGGTCTGTGAGGTTGGCTTTCTTCTTGGTGGTGTTGGTGGTGTTGGCTGCTTTGGCTGAGGCT3’
Methods
The gene fragments were assembled using overlap extension pcr and introduced into a vector, which should have been transiently expressed in protoplasts of P. patens. Two days after transformation, the protoplasts were supposed to undergo DAPI-staining to measure the cellular phosphate concentration. Measurements should have been conducted for 5 days until the concentration of expressed enzymes starts to decrease.
Results
Unfortunately, both of the OE-PCRs of the E. coli PPKs with vacuolar import signal did not work and we did not have enough time to repeat our experiments. This circumstance leads to the fact that we were unable to perform a transformation and DAPI-staining. One plate which is representative for the other plates can be seen in figure 1.
Schaaf, Andreas & Reski, Ralf & Decker, Eva. (2004). A novel aspartic proteinase is targeted to the secretory pathway and to the vacuole in the moss Physcomitrella patens. European journal of cell biology. 83. 145-52.