Team:Hainan China/Parts

Parts

Biological Design

In synthetic biology, biological parts are built and assembled as device, which is then transformed into cellular chassis to create novel function and/or products. This concept is employed throughout our iGEM project.

Through a series of exploration and experiments, we have seen the importance of some nutrients, such as N, P and vitamin B₁₂ (VB₁₂) on the maintenance of healthy coral reefs. In particular, VB₁₂ was found to be a most critical nutrient for the growth of healthy symbiont zooxanthellae. We thus directed our experimental efforts on the improvement of micro ecosystem for the coral symbiosis by supply of sufficient VB₁₂. Production of vitamin B₁₂ in the coral micro-ecoenvironment was made a “smart” probiotic bacterium, Pseudomonas denitrificans which was modified in a synthetic biology way to enhance its VB₁₂ productivity .

Pseudomonas denitrificans is used in our project as the cellular chassis for the production of vitamin B₁₂, It is safe-to-use with fast growth rate. P. denitrificans can dissolve phosphorus, release potassium, fix nitrogen. Most importantly, it is capable of production of vitamin B₁₂ in industrial scale ^[1][2]. However, P. denitrificans would exhaust a high level of oxygen when synthesizing vitamin B₁₂ which may retard its growth and metabolism. Traditional, vitamin B₁₂ production will be enhanced mainly with the increase of oxygen supply using higher oxygen pumping speed. This measure leads to higher energy consumption ^[3]. The secret of our success is that we have introduced the vgb gene from marine microalga as a biological part into P. denitrificans to minimize oxygen demands for VB₁₂ production. vgb gene has been proven to transfer oxygen through the respiratory chain for cellular oxygen supply ^[4][5].

Biological Parts

Nowadays, the synthesis of vitamin B₁₂ is well developed and the industrial production of vitamin B₁₂ is through Pseudomonas denitrificans fermentation.
Schematic diagram of the synthetic biology part of our project is shown below.

The plasmid pOJ260 is made by insertion of vgb gene, a constitutive promoter, and the homologous arm of the P. denitrificans. Below is the engineered plasmid:

In our project, we added new parts that are not used by previous iGEM teams. Here is a table showing the plasmid information

VGB gene from marine microalga Vitreoscilla sp.:

We used the vgb gene cloned from the marine microalga Vitreoscilla sp as the biological part. When vgb gene is inserted into P. denitrificans, the construct will maximize its VB₁₂ production at micro-aerobic environment.
ORF of vgb gene: ATGTTAGACCAGCAAACCATTAACATCATCAAAGCCACTGTTCCTGTATTGAAGGAGCATGGCGTTACCATTACCACGACTTTTTATAAAAACTT
GTTTGCCAAACACCCTGAAGTACGTCCTTTGTTTGATATGGGTCGCCAAGAATCTTTGGAGCAGCCTAAGGCTTTGGCGATGACGGTATTGG
CGGCAGCGCAAAACATTGAAAATTTGCCAGCTATTTTGCCTGCGGTCAAAAAAATTGCAGTCAAACATTGTCAAGCAGGCGTGGCAGCAGC
GCATTATCCGATTGTCGGTCAAGAATTGTTGGGTGCGATTAAAGAAGTATTGGGCGATGCCGCAACCGATGACATTTTGGACGCGTGGGGCA
AGGCTTATGGCGTGATTGCAGATGTGTTTATTCAAGTGGAAGCAGATTTGTACGCTCAAGCGGTTGAATAA
Promotor of the VGB gene of the marine microalga Vitreoscilla sp.:
This promoter, provgb, is relatively different from the promoter used by previous iGEM teams because it is relatively longer in sequence.
Sequence of the promoter of the vgb gene of the Vitreoscilla sp.:
AACAGCATGAGCCGCAATGGTTGTGGGTATGGCAACAAGATGGCAGCTTGGCTTTGATGCCTTTGGAGCATCAAACGACAGTTTGTGCGGC
AGAGCAAACCGAATGTCGCATTACCGTTCAATTGGGTGATGAGAAACCTCAAACTTATCCTGTTCAAGCGACCGAACACACATGGAAGTTGC
AATCGCCTGCCGATACAGTGGCTTTGTCATTGCGTTTGCAACAAGAGCAGCGCATGACCATTACTTGGCAAGACCAAGAGCGACCTGCGGT
GTTTCAGGCCGCTGTGTTTCCAAGTGAGTTTTTGGTGGATGGCGCCACTCAATAAATGGTCATTGTGAGCATGATGTCAAAACGCCCATTAA
GGGCGTTTTTTATAGCAGCAACATAAATAGTTTCAGCCATTAAATTCAATGTGAAAAAGCTTACAGGACGCTGGGGTTAAAAGTATTTGAGTTT
TGATGTGGATTAAGTTTTAAGAGGCAATAAAGATTATAATAAGTGCTGCTACACCATACTGATGTATGGCAAAACCATAATAATGAACTTAAGGA
AGACCCTC
Homologous sequence of Pseudomonas denitrificans:
This is our another contribution for the project. iGEM registry does not contain this homologous sequence of Pseudomonas denitrificans so we could upload it to iGEM registry.
Sequence of the homologous sequence of Pseudomonas denitrificans:
GAAGCCGAAGCAGGTGCCGGCCTTGCCGGCGGATCGCGGGCATGGGCCAGGCGCCCCCGCCCTTCCTACGGTGTGCTACTCACCCACC
GGTAACATTTTCCTGCGACAAAATGAGGCGCCAGGAAACAATTTGCACAGCTTCGGTGCGTCTTTCTTGTCTGCCAGGAGTGGGTCGATAT
CGCGCACCCCACAAGGTGTCTGGGGTTCGGTATTTGTGGCCCAATTACTGCAGGTAAATTGGGTTTTACTATCCGCTTTCGGATCACGTAAA
CTCCGCGACGTCAAGCTGCCGGGGTCCTCTCTCCGGCGCTTCTATAATTACTTGTCGCATTGAAGAAATAACCGCTCAGGGGCTGTCGCTA
GAATGCCGCTCACCCCGGTAGGCGTGCTTTTCCACGAGAAAGACGCCGGCAATGCGCAGAAAACAACAACCTTCACTTCTGCACGGGCA
GCCTGGGACAACCCCTTTCTCCTGCCAATCGAAGTCCTACCCTCGAAGGAGTTACTGATGAAGAAGTTTGCACTTCTCGGTGCGCTGGCC
CTGTCCGCGC
pOJ260:
We have used pOJ260 as our plasmid for vgb gene transformation. pOJ260 is a type of suicidal plasmid with amphotericin Apr prokaryotic resistance ^[6]. This plasmid has metastatic replicon oriT, and the vgb gene is inserted in the multiple cloning site of the gene lacZalpha. pOJ260 will be transformed into E. coli S17 to replace the target gene. This plasmid is also not used by other iGEM teams.

E. coli S17:
The engineering plasmid POJ260⁺ was transferred into E. coli S17. The vgb gene in E. coli S17 was then transferred to P. denitrificans through conjugal transformation, and then a homologous recombination will occur in the P. denitrificans. (Conjugal transformation: a method in which bacteria uses physical bridge to transfer its genetic material to another bacteria ^[7]; Conjugal transformation is the only method of horizontal gene transfer happening via contact of bacteria)

Figure 2: the concept of conjugal transfer

Chassis –Pseudomonas denitrificans
After conjugation, the biological part with vgb gene was loaded onto the cellular chassis for an efficient VB₁₂ synthesis. It could become a probiotic bacterium to provide nutrition for the coral symbiotic system.

The gel electropheresis results (Figure 3. E, F) showed that we have successfully obtained genectically engineered Pseudomonas denitrificans construct

Figure 3. Construction of Recombinant Plasmid. (A) PCR result of the insert gene module. (B) double enzyme digested gene module (1) and linearized pOJ260 (2). (C) transformation result of the E.coli S17. (D) PCR verification of the single colony. (E) conjugal transformation result of the Pseudomonas denitrificans. (F) PCR verification of the single colony. M DS5000 marker.

References:

1. Fang, H., Kang, J., & Zhang, D. (2017). Microbial production of vitamin B₁₂: a review and future perspectives. Microbial Cell Factories, 16, 15. http://doi.org/10.1186/s12934-017-0631-y
2. Koike I. & Hattori A. 1975. Energy yield of denitrification: an estimate from growth yield in continuous cultures of Pseudomonas denitrificans under nitrate-, nitrite-, and nitrous oxide-limited conditions. Microbiology, 88, 11-19
3. Chapter Fifteen - Applications of the VHb Gene vgb for Improved Microbial Fermentation Processes, Xiao-XingWei*Guo-Qiang Chen; Department of Biological Sciences and Biotechnology, Tsinghua University, Beijing, China; Multidisciplinary Research Center, Shantou University, Guangdong, China
4. SHI Hui-lin,WANG Ze-jian,WU Jie-qun,GUO Mei-jin,CHU Ju,ZHUANG Ying-ping. Expression of Vitreosicilla Hemoglobin Gene(vgb) In Pseudomonas denitrificans and the Central Carbon Metabolic Flux Analysis on Vitamin B₁₂ Production[J]. China Biotechnology, 2016, 36(9): 21-30.
5. Stark B C, Pagilla K R, Dikshit K L. Recent applications of Vitreosicilla hemoglobin technology in bioproduct synthesis and bioremediation. Applied Microbiology and Biotechnology , 2015, 99 (4) : 1627–1636. DOI:10.1007/s00253-014-6350-y
6. https://www.lifescience-market.com/plasmid-c-94/poj260-p-108788.html
7. Kara Rogers; Horizontal gene transfer; Encyclopædia Britannica; August 22, 2019; https://www.britannica.com/science/horizontal-gene-transfer