Team:Stanford/Parts
Contribution: Parts List
Parts Overview
This summer, the Stanford iGEM team worked to develop 8 new parts as a part of our goal to develop a live-cell based nucleic acid detection system. These parts can be grouped into three groups: reporters, recombination-based detectors, and toeholds. In addition, we constructed a part for a Signal Amplifer device that was not able to be tested in lab, but that we have still provided.
Many parts in the Directory are compatible with, but not optimized for, Bacillus subtilis. We created a variety of parts and tools that are specially designed and optimized for use in B. subtilis, such as mCherry BSU and YFP BSU.
These parts were combined to create the two detection systems that we worked in parallel to design and test: detection through in-vivo toehold production and recombination-based detection.
<groupparts>iGEM20 Stanford</groupparts>
Reporters
As a part of our project, we created two different kinds of reporters for our different detection systems: fluorescent reporters for use in our toehold detection system, and a negative selection marker for use in our recombination-based system. All of these reporters were engineered to be optimized for production and use in B. subtilis. Furthermore, we made silent mutations within the coding sequences of these reporters in order to make them easily to assemble.
mCherry BSU (BBa_K3697000)
This is the coding sequence for producing a codon-optimized mCherry in B. subtilis. mCherry is a derivative of RFP. mCherry_BSU was created by codon-optimizing an E. coli mCherry for expression B. subtilis. When paired with a strong RBS and constitutive promotor (BBa_K3697010), mCherry_BSU can be quantified using a plate reader, and transformed B. subtilis colonies can be moderately red to the naked eye. mCherry_BSU has an excitation peak at 585 nm and a peak emission at 615 nm.
YFP CDS (BBa_K3697008)
This part is a yellow fluorescent protein optimized for use in Bacillus subtilis. It can be used as a reporter or signaling protein in B. subtilis or E. coli. Although it is optimized for expression in B. subtilis, E. coli are capable of translating this YFP. When highly expressed in B. subtilis, it will produce a signal that can be visualized using a plate reader. When highly expressed in E. coli, it produces a signal that can be seen with the naked eye. YFP has and excitation peak of 514 nm and emission peak of 527 nm.
mCherry_BSU Plasmid (BBa_K3697010)
This part is an expression vector for Bacillus subtilis that produces codon-optimized mCherry_BSU, for integration into Bacillus subtilis at the AmyE loci (BBa_K143001). mCherry_BSU is under pVeg expression (BBa_K143012), the strongest constitutive promotor known in B. subtilis. Plasmid expresses kanamycin resistance in B. subtilis, and ampicillin resistance for cloning in E. coli.
pVEG YFP Plasmid for B. subtilis (BBa_K3697009)
This part is an expression vector for Bacillus subtilis that produces codon-optimized YFP, for integration into Bacillus subtilis at the AmyE loci (BBa_K143001). YFP is under pVeg expression (BBa_K143012), the strongest constitutive promotor known in B. subtilis. Plasmid expresses kanamycin resistance in B. subtilis, and ampicillin resistance for cloning in E. coli.
ManP Expression Casette (BBa_K3697002)
This part is the expression cassette for expressing manP in B. subtilis. It includes the natural RBS and promoter for the manP gene found in Bacillus Subtilis 168 and the coding sequence is also the same with the exception of two sites: the starting at position 348 and ending at 350 and the codon starting at 2012 and ending at 2014 where a silent mutation for a CTG codon was turned into a TTA codon in accordance with TTA being B. Subtilis' favored codon for leucine in B. subtilis [1]. Because of this, this cassette can be used in B. subtilis to produce this transporter protein at normal levels.
Recombination-Based Detectors
One of the detection systems we designed utilized B. subtilis’ natural competence and recombination systems to enable detection of extracellular nucleic acid sequences. These were the tools we designed in order to interface with these natural systems in order to enable detection.
Homology Arms for KanR Integration In B. subtilis (BBa_K3697003)
This part is derived from a portion of the pOpen Yeast plasmid between the AarI and MspA1I cut sites. More information about pOpen Yeast and how to get it through Stanford Free Genes can be found on their website and at this link. This sequence was then divided into two homology arms (homology arm 1 and homology arm 2 as marked in the annotations for the part) which should flank the region in the genome where the user would like the recombination to occur. When incorporated into the B. subtilis genome, these two sequences (homology arm 1 and homology arm 2) become the two homology arms needed to trigger B. subtilis' natural process of recombination in response to fragment of DNA containing the same sequence (the sequence listed on the Registry page without the ATG labelled as "gene/fragment to be flanked").
Recombination-Based Detection System for B. subtilis (ManP) (BBa_K3697004)
This system, once incorporated into the B. Subtilis will act as a detection system for a customizable nucleic acid sequence corresponding to the sequence with homology to the "homology arms" of the system. When exposed to the target sequence a recombination event will be triggered causing the excision of the negative selection marker that is flanked by the homology arms. More information about the specific negative selection marker used in this system can be found in the documentation for part BBa_K3697002 and more information about the specific set of homology arms used in this system can be found in the documentation for part BBa_K3697003.
Toeholds
The other detection system that we designed for our system relied on the production of in-vivo toehold switches that could be triggered by the nucleic acid sequence of interest. As a part of designing this system, we created 24 toehold switches to different targets. The toehold we were able to test is included and described below. The only difference between this toehold and the other toeholds we created was the sequence labelled “target” in the annotations on the parts page.
Toehold for Detection of KanR in B. subtilis (BBa_K3697011)
This DNA codes for a toehold switch to be produced in B. subtilis. This toehold switch will help assist in the detection of the DNA sequence GUCCUUUGCUCGGAAGAGUAUGAAGAUGAACAAAGC (a part of the KanR gene) once this sequence is brought into the cell by B. subtilis' natural competence system.
Signal Amplifying Device
As a part of our project, we designed a signal amplifying device in order to create a faster colorimetric readout in response to detection from either of our systems. This DNA construct was ordered by the team, but due to limited time in lab space because of the COVID-19 pandemic, we were unable to test out the device. However, it is included because we plan to test it after the iGEM competition and we hope the contribution could hope future teams.
Signal Amplifier Using B. subtilis Quorum Sensing Molecule comX(BBa_K3697012)
This is a signal amplification device that allows a signal from a few cells to produce a whole-colony response. This operates via the comX quorum sensing pathway. Normally, once B. subtilis cells reach a critical population density, their quorum sensing molecules activate global pathways to produce community-wide goods. One such quorum molecule is comX, and at a critical density, it activates pathways which result in the activation of the srfA-promoter (PsrfA). PsrfA activation upregulates the downstream production of surfactant molecules. In our project, we engineered a signal amplifier pathway by placing comX and luxABCDE genes under the control of PsrfA. The result is this: once a critical amount of cells are exposed to the comX molecule, a feed-forward loop is triggered where PsrfA is activated to produce more comX and luxABCDE in a whole-colony response.
