Engineering success for the improvement of the mevalonate pathway

Our aim was to create a nutritious and tasty yeast for food supplements. This aim involved the production of β-carotene, limonene and geraniol. These three compounds derive from the mevalonate pathway. The model developed to demonstrate the feasibility of the project highlighted that production yield is a controlling parameter of the system, which led us to design, build and validate a chassis strain optimized for the production of β-carotene, limonene and geraniol. This is why the improvement of this pathway was required to reach sufficient yields.
In this page, we present how we succeeded in the improvement of the mevalonate pathway. These successes resulted in the construction and the validation of the following parts:

BBa_K3570000: contains all biobricks need to improve the mevalonate pathway.

BBa_K3570006: contains the upstream sequence of DPP1 used as integration locus.

BBa_K3570007: contains the downstream sequence of DPP1 used as integration locus.

BBa_K3570008: contains the HIS3 selectable marker.

Research and design a strategy

Our strategy to improve the mevalonate pathway is to integrate a truncated version of tHMG1 and the gene coding for CrtE from Xanthophyllomyces dendrorhous in the yeast genome.
tHMG1 is the rate-limiting enzyme in the mevalonate pathway [1]. A truncated version of tHMG1 is known to enhance the conversion of 3-hydroxy-3-methylglutaryl-CoA into mevalonate [2]. On the other hand, the production of β-carotene is usually low and should be prioritized over limonene and geraniol. β-carotene synthesis is highly dependent on the level of GGPP. The enzyme CrtE from X. dendrorhous is a GGPP synthase more efficient than the native GGPP synthase of S. cerevisiae.
The strain used was named BY4741 ∆Gal4 and has four auxotrophies (Leucine, Methionine, Uracil and Histidine) which have been used to select the integrations of our project components. The ∆Gal4 property was necessary for the regulation of the production of flavors (limonene/geraniol/brazein) which we will not be talked about here.

Design of our cloning strategy

The first part of our strategy consisted in cloning the genes of interest into a pUC19 vector for amplification in E. coli. We chose the bidirectional TDH3-TEF1 promoter and the terminators tCYC1 and tPGK. For the yeast genome integration, the integrative locus used was DPP1 and the selective locus used is HIS3. Note that neither the DPP1 targeting sequence nor the HIS3 sequence were present on the registry. This added some extra-challenge here but we needed 4 different loci and selection markers for our project and these could be of interest for future iGEMers.

Fig. 2: tHMG1-CrtE-pUC19.

The cloning strategy was to clone the blocks into two vectors before bringing them together in a unique plasmid (figure 3). The blocks B14, B15 and B16 are to be cloned in pUC19 using InFusion kit from TaKaRa Bio to form pUC19-B14B15B16. pUC19 is linearized by SbfI and BamHI to insert blocks B14, B15 and B16. The other blocks B17, B18 and B19 are to be cloned in another pUC19 using InFusion kit to form pUC19-B17B18B19. pUC19 will then be linearized by BamHI and EcoRI to insert blocks B17, B18 and B19.
pUC19-B17B18B19 is used as a template vector to insert the sequence of B14B15B16 from pUC19-B14B15B16 using SbfI and BamHI restriction enzymes and T4 DNA ligase. The resulting plasmid pUC19-B14B15B16B17B18B19 should contain B14B15B16B17B18B19 which is our BBa_K3570000 part. See our clonings experiments here .

B14 corresponds to the BBa_K3570006 part.
B18 corresponds to the BBa_K3570008 part.
B19 corresponds to the BBa_K3570007 part.

Fig. 3: Cloning strategy of tHMG1 and CrtE in pUC19.

The second part of our cloning strategy consists in the extraction of pUC19-B14B15B16B17B18B19 from E. coli, its digestion by SbfI and EcoRI and transformation ofSbffI-EcoRI DNA fragment into yeast cells in order to integrate the insert containing blocks B14 to B19 (experiments) in the in yeast genome. Transformed yeasts are grown on YNB LEU+, URA+, MET+ HIS- with 2% (g/100ml) glucose. GGPP is extracted from yeast cells and analyzed by LC-MS (See our experiments here ).
We will have to grow the transformed yeast on YNB leu+, ura+, met+ his- with 2% (g/100 ml) of glucose. GGPP will have to be extracted from yeast and analyzed by LC-MS.

Results of the experiments

Construction of pUC19-B14B15B16:

The gBlocks B14, B15 and B16 have been amplified by PCR with CloneAmp HiFi PCR and then purified by NucleoSpin Gel and PCR Clean-up (Figure 4).

Figure 4: PCR verification of the digested pUC19 and the three gBlocks B14, B15 and B16. Expected size of DNA fragments are at 2.6 kb, 0.4 kb, 1.8 kb and 1.0 kb respectively

pUC19 was digested by SbfI - BamHI and prepared to receive the PCR products B14, B15 and B16 using InFusion kit. After transformation of Stellar cells, selection of clones on ampicillin plates, and plasmid extraction from 8 clones, we performed a digestion restriction profile analysis using SacI (Figure 5).

Figure 5: Verification using the InFusion kit: the expected sizes were 4.8 kb and 1.2 kb

We had six clones that had the expected profile. Since the sequence was also validated, we had successfully obtained the first plasmid of our tHmg1-CrtE construction.

Assembly of the pUC19-B17B18B19:

The gBlocks B17, B18 and B19 have been amplified by PCR with CloneAmp HiFi PCR and then purified by NucleoSpin Gel and PCR Clean-up (Figure 6).

Figure 6: PCR verification of the digested pUC19 and gBlocks B17, B18, B19

We digested the pUC19 vector by BamHI and EcoRI and purified the digested vector on gel. We proceeded to the InFusion kit reaction, transformation of Stellar cells, selection on ampicillin, and minipreps from 6 clones. The plasmids were assessed by restriction profiling with the enzymes BamHI and EcoRI.

Figure 7: Verification using the InFusion Kit: the expected sizes were 4.8 kb and 2.6 kb

Only one clone had the expected profile (figure 7). We sent it to sequencing and it was fortunately valid. We had successfully obtained the second plasmid of our tHMG1-CrtE insert.

Assembly of tHmg1-CrtE insert:

The next step was to combine both plasmids by subcloning the fragment B14B15B16 into plasmid pUC19-B17B18B19.
To do this, we first prepared plasmids with the QIAGEN Plasmid Plus Midi Kit. Then, we digested both plasmids with SbfI and BamHI and purified the resulting DNA materials with the Monarch Genomic DNA Purification Kit by NEB. Fragments were ligated together with T4 DNA ligase by NEB followed by a transformation into Stellar cells (ampicillin selection). Over eight assessed colonies, two presented the expected restriction profile (number 1 and 3) when digested with SbfI and EcoRI, albeit the digestion was not complete (Figure 8).

Figure 8: Ligation verification: the expected sizes are 6.6 kb and 2.6 kb.

Yeast transformation

Since the construction was successful, we proceeded to the yeast transformation. The plasmid was digested with enzymes SbfI and EcoRI and purified to transform the strain BY4741 Saccharomyces cerevisiae. The resulting cells were grown on YNB LEU+, URA+, MET+ HIS- with 2% glucose for 3 days. At the third try, we were able to observe around 20 colonies in our yeast transformation, about the same amount of colonies on the positive control and none on the negative control plate which consisted of wild BY4741 on YNB LEU+, URA+, MET+ HIS-.

Verification of integration of BBa_K3570000 using the DPP1 homology sequence (BBa_K3570006 and BBa_K3570007) was performed by a genomic PCR using the TaKaRa PCR amplification Kit and the following primers: primer 1 (forward) hybridizes on our selectable marker HIS3 while primer 2 (reverse) hybridizes upstream of the DPP1 gene.

Primer 1: ATCAGGATTTGCGCCTTT

Primer 2: GCCGCCGAGGGTATTTTACTTCCG

We randomly chose eight clones from our transformation and one from the positive control plate (Figure 9). All clones have the expected size (1.2 kb), and the PCR negative control, where we inserted pRS313 does not show any band , which means that the BBa_K3570000 part is well integrated in the yeast genome. The integration in the yeast genome is a success that means that the parts BBa_K3570008 (HIS3 selective marker), BBa_K3570006 and BBa_K3570007 (for DPP1 homologous sequence) all work. Our modified strain is BY4741 DPP1::tHMG1-crtE.

Figure 9: Verification of the integration of BBa_K3570000 part into the yeast genome by PCR. BBa_K3570000 size is 1.2 kb.

Analysis and Validation of the constructed strains

The integration of the BBa_K3570000 part in the yeast genome should enhance the flow of the mevalonate pathway. This modification should result in an increase of the concentration of GGPP, which is the precursor of beta-carotene. GGPP have been extracted from BY4741 DPP1::tHMG1-crtE and analyzed by LC-MS (see our experiments here ).
Our strain BY4741 DPP1::tHMG1-crtE showed a five-fold increase in GGPP concentration in comparison with the wild-type yeast (figure 10). This important result demonstrates that the parts BBa_K3570000, BBa_K3570006, BBa_K3570007 and BBa_K3570008 work.

Figure 10: Results of the GGPP analysis from culture on YNB with 2% Glucose by LC-MS

Data from the literature [2] suggest a stable turn-over of mevalonate pathway intermediates in native and engineered S. cerevisiae strains, i.e. a stable ratio between the GGPP production flux and its concentration. This would indicate that our strain optimization strategy successfully enhances by five-fold the capability of GGPP production, and thus the potential of β-carotene production. Moreover, the increased flux through the mevalonate pathway is expected to increase not only β-carotene production, but also the production of limonene and geraniol (a provitamin A, a flavor of lemon and of rose) synthesized from other mevalonate intermediates.

References

[1]

Misawa, N., 2011. Pathway engineering for functional isoprenoids. Curr. Opin. Biotechnol. 22, 627–633. http://dx.doi.org/10.1016/j.copbio.2011.01.002

[2]

Hery Rabeharindranto, Sara Castaño-Cerezo, Thomas Lautier, Luis F. Garcia-Alles, Christian Treitz, Andreas Tholey, Gilles Truan, 2019. Enzyme-fusion strategies for redirecting and improving carotenoid synthesis in S. cerevisiae. Metabolic Engineering Communications 8 (2019) e00086. https://doi.org/10.1016/j.mec.2019.e00086

[3]

Polakowski, T., Stahl, U., & Lang, C. (1998). Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast. Applied Microbiology and Biotechnology, 49(1), 66–71. https://doi.org/10.1007/s002530051138

[4]

Verwaal, R., Wang, J., Meijnen, J.-P., Visser, H., Sandmann, G., van den Berg, J. A., & van Ooyen, A. J. J. (2007). High-Level Production of Beta-Carotene in Saccharomyces cerevisiae by Successive Transformation with Carotenogenic Genes from Xanthophyllomyces dendrorhous. Applied and Environmental Microbiology, 73(13), 4342–4350. https://doi.org/10.1128/aem.02759-06

[5]

Peng, B., Williams, T. C., Henry, M., Nielsen, L. K., & Vickers, C. E. (2015). Controlling heterologous gene expression in yeast cell factories on different carbon substrates and across the diauxic shift: a comparison of yeast promoter activities. Microbial Cell Factories, 14(1). https://doi.org/10.1186/s12934-015-0278-5

[6]

SGD:S000003424

[7]

SGD:S000006284

[8]

Curran, K. A., Karim, A. S., Gupta, A., & Alper, H. S. (2013). Use of expression-enhancing terminators in Saccharomyces cerevisiae to increase mRNA half-life and improve gene expression control for metabolic engineering applications. Metabolic Engineering, 19, 88–97. https://doi.org/10.1016/j.ymben.2013.07.001

[9]

S. cerevisiae genome, chromosome XVI, Ty4 LTR region. GenBank: CP046096.1

[10]

RS313 plasmid

Go to Notebook