Team:Toulouse INSA-UPS/Experiments

Materials


Plasmids and other DNA fragments


Plasmids


pUC19
This vector was used as a receiver for most of our intermediate clonings. It contains an ampicillin resistance gene, MCS and LacZ gene. This is a high copy number vector. This was a kind gift from Dr. Gilles Truan from TBI.


pFL36
This plasmid was used to retrieve the LEU2 auxotrophic marker. It contains the ampicillin resistance gene.This was a kind gift from Dr. Anthony Henras from IBCG.


pMRI34
This plasmid was used to retrieve the DPP up and down homologous sequence, as well as the crtE and tHMG1 genes. It also contains the ADH1 terminator and CYC1 terminator. This was a kind gift from Dr. Gilles Truan from TBI.


pRS313
This plasmid was used as a positive control during the yeast transformation because it has a HIS3 auxotrophic marker. It also contains ampicillin resistance gene.This was a kind gift from Dr. Anthony Henras from IBCG.


pENZ-047
This plasmid was used as a source for TDH3 and TEF1 promoters. It contains an ampicillin resistance gene. This was a kind gift from Dr. Gilles Truan from TBI.


pHR0016
This plasmid was used as a source of HO up and down homologous sequence, CrtYBekI gene (fusion protein of CrtYB + ek linker + CrtI) and the CYC1 terminator. It contains kanamycin resistance gene. This was a kind gift from Dr. Gilles Truan from TBI.


pFL38
This plasmid was used as a source of URA3 auxotrophic marker. It contains ampicillin resistance gene. This was a kind gift from Dr. Anthony Henras from IBCG.


pL38
This plasmid was used as a source to retrieve the GFP protein, C120 “forward” and “reverse” promoter. It contains an ampicillin resistance gene.This was a kind gift from Sylvain Pouzet PhD student at University Paris Diderot.


pL105
This plasmid was used as a source of NLS-VP16-EL222. It contains ampicillin resistance gene.This was a kind gift from Sylvain Pouzet PhD student at University Paris Diderot.

IDT-ordered fragments


Brazzein protein
ATGGACAAATGCAAAAAAGTATACGAAAATTATCCAGTTTCTAAATGTCAACTAGCAAACCAGTGTAATTATGACTGTAAGTTGGATAAGCACGCTAGGTCAGGTGAATGCTTTTACGATGAGAAGAGAAACTTACAATGTATTTGCGATTATTGTGAATAC


Geraniol synthase protein
ATGTCTTCATCATCATCATCATCTTCATCCATGTCTCTGCCTTTGGCAACTCCATTGATCAAAGACAATGAATCTCTCATCAAGTTCTTGCGCCAACCCCTGGTGCTTCCTCATGAGGTTGATGACAGCACAAAAAGGAGGGAATTGTTGGAAAGAACAAGAAAAGAACTAGAATTAAATGCAGAAAAACCATTGGAGGCCTTGAAGATGATAGATATAATTCAAAGATTGGGATTATCATATCATTTTGAAGATGATATTAATTCAATTCTCACAGGATTTTCAAATATTAGCAGCCAAACTCATGAAGGTTTGTTGACTGCTTCACTTTGTTTTCGATTGCTTCGACACAATGGGCATAAGATCAATCCTGATATATTCCAAAAATTCATGGACAACAATGGAAAGTTTAAAGATTCATTAAAGGATGACACATTAGGCATGTTAAGCTTATATGAAGCTTCATATTTGGGAGCCAATGGAGAAGAAATATTGATGGAAGCCCAAGAGTTCACCAAAACTCACCTGAAAAACTCATTGCCAGCCATGGCACCATCTCTTTCTAAGAAGGTTTCTCAAGCTTTAGAGCAACCAAGACATAGAAGAATGTTGAGGTTAGAAGCTAGAAGATTTATTGAAGAATATGGTGCTGAAAATGACCATAATCCAGACCTTCTTGAGCTTGCAAAATTGGATTATAACAAAGTCCAATCTCTACACCAAATGGAATTGTCTGAGATAACAAGGTGGTGGAAACAATTAGGGCTTGTGGATAAACTCACCTTTGTTGGAAATCGACCCCTTGAATGCTTTCTTTGGACAGTGGGATTATTACCAGAGCCTAAGTATTCAGGTTGCAGAATTGAGCTTGCAAAAACCATAGCCATTTTGCTTGTCATTGATGATATCTTTGATACTCATGGTACCCTAGATGAGCTTCTTCTATTCACTAATGCCATTAAAAGATGGGATCTTGAGGCCATGGAAGATTTACCAGAATATATGAGAATTTGTTACATGGCATTGTACAATACTACTAATGAAATTTGCTAT


YPRCdelta15 up homologous sequence
GCCAGGCGCCTTTATATCATATAATTAAGACACAAAAGGATAAAACAAAGGTGTTAACTATTCTGCATACTCACTATCGTAAACTGTCCTGCAAATCGTGTAAATATGTATTTCATTTTTTTTGCAGTGAAAAAAGGCATGTAAAATACCGCATCAAGTAACTCTACTCCGCCTGTGGTTTCAAGACTAACGGCTTGAGACAAAATGGGAAGAAATGATTGCAGAAAAGCCATATGTGTAATAGCAAAAAGCTGGATAGTGCTTACCAGATGTTTACCTTAATTTCTTGGTGAATTAGAGAAGTACAGAAGTTTTACTATTAATCCCACCATAGAAATTTGTATAGGAAAGTAGTTTATTGGAGTTATTGGATATACTGTGTAAACTATTTCTTGAAATTGTAATCTTAAGATGCTTTGTTAATTCTATTAAAAATAGAAAATGATTTTCATATgTATTTcTTTATTTATATcTTGGCATTACTCTTCATCATTTTTTTCCCTCTAAGAAGCTTCCTTTCTTTTTATAAGGATAACAAAACCAAAAGGAATATTGGGTCAGATGAATGGACGCGAATGCAAGACAGAAGTCCAAATCACGTCAAGACAAAGAAAGAAAGAAAGAAAAACTAACACATTAATGTAGTTTTAAAATTTCAAATCCGAACAACAGAGCATAGGGTTTCGCAAA


YPRCdelta15 down homologous sequence
AATGGAAGGTCGGGATGAGCATATACAAGCACTAAGAAGAACAATACAGAACTCTACACGGTATTATTGTGCTACAAGTTGGAATAAAACCGAGTGTTTTGACGATACTAACGTTGTTAAGAAAGTAACTTGTTATCAAACTCATTACCAACTTGTGATTAATTGGTGAATAATATGATAATTGTCGAAATTCCATTGTTGGTAAAGCCTATAATATTATGTATACAGATTATACTAGAAATTCTTTGGAAAATATAAGAATCCCCAAAATTGAATCGGTATTTCTACATACTAATATTACCATTACTTCTCCTTTCGTTTTATATGTTTCATTCCTATTACATTATCGATCTTTGCATTTCAGCTTCCATTATATTTGATGTCTGTTTTATGTCCCCACGTTACACCGCATGTGACAGTATACTTCTAACATGAGTGCTACCGAATAGATGACATTTTAGACTTTCATTCCAACAACTTGGTTGACAGAATGTTACGTACCCTATATCTAATCTATATGAGGCCTGAATCTAACTGAAAGGTGGAATTTCAGTAATTTATCAAGCTTTAATAAGTTTGGGTAGTTTAACTGTGCAAAAAGGTATTTACCTTACATACTGAATCTTGTCTGTTTGGTAGCGGCTGCTTTAT


GAL1/10 bidirectional promoter
GTTTTTTCTCCTTGACGTTAAAGTATAGAGGTATATTAACAATTTTTTGTTGATACTTTTATTACATTTGAATAAGAAGTAATACAAACCGAAAATGTTGAAAGTATTAGTTAAAGTGGTTATGCAGTTTTTGCATTTATATATCTGTTAATAGATCAAAAATCATCGCTTCGCTGATTAATTACCCCAGAAATAAGGCTAAAAAACTAATCGCATTATCATCCTATGGTTGTTAATTTGATTCGTTCATTTGAAGGTTTGTGGGGCCAGGTTACTGCCAATTTTTCCTCTTCATAACCATAAAAGCTAGTATTGTAGAATCTTTATTGTTCGGAGCAGTGCGGCGCGAGGCACATCTGCGTTTCAGGAACGCGACCGGTGAAGACGAGGACGCACGGAGGAGAGTCTTCCTTCGGAGGGCTGTCACCCGCTCGGCGGCTTCTAATCCGTACTTCAATATAGCAATGAGCAGTTAAGCGTATTACTGAAAGTTCCAAAGAGAAGGTTTTTTTAGGCTAAGATAATGGGGCTCTTTACATTTCCACAACATATAAGTAAGATTAGATATGGATATGTATATGGATATGTATATGGTGGTAATGCCATGTAATATGATTATTAAACTTCTTTGCGTCCATCCAAAAAAAAAGTAAGAATTTTTGAAAATTC


PGK terminator
ATTGAATTGAATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTCCCCATCCTTTACGCTAAAATAATAGTTTATTTTATTTTTTGAATATTTATTATTTATATACGTATATATAGACTATTATTTATCTTTTAATGATTATTAAGATTTTTATTAAAAAAAAATTCGCTCCTCTTTTAATGCCTTTATGCAGTTTTTTTTTCCCATTCGATATTTCTATGTTCGGGTTCAGCGTATTTTAAGTTTA


GBD-PHYA fusion protein
ATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATGATTTTGAAAATGGATTCTTTACAGGATATAAAAGCATTGTTAACAGGATTATTTGTACAAGATAATGTGAATAAAGATGCCGTCACAGATAGATTGGCTTCAGTGGAGACTGATATGCCTCTAACATTGAGACAGCATAGAATAAGTGCGACATCATCATCGGAAGAGAGTAGTAACAAAGGTCAAAGACAGTTGACTGTATCGCCGGAATTTGTAATACGACTCACTATAGGGCGAGCCGCCATCATGGAGGAGCAGAAGCTGATCTCAGAGGAGGACCTGATGTCAGGCTCTAGGCCGACTCAATCCTCTGAGGGCTCAAGGCGATCACGCCACAGCGCTAGAATTATTGCGCAGACCACTGTAGATGCGAAACTCCATGCTGATTTCGAAGAATCAGGCTCTTCCTTTGACTACTCAACCTCTGTACGTGTCACTGGCCCAGTTGTCGAAAATCAACCACCAAGATCTGACAAAGTTACCACGACTTATTTACATCATATACAGAAAGGAAAGTTAATTCAACCCTTCGGTTGTTTACTTGCCTTGGATGAAAAAACCTTCAAAGTTATTGCATACTCTGAGAATGCATCTGAACTGTTGACAATGGCCAGTCATGCAGTTCCTAGTGTTGGCGAACACCCTGTTCTAGGCATTGGCACAGATATAAGGTCACTTTTCACTGCTCCTAGTGCGTCTGCATTGCAAAAAGCCCTTGGATTTGGAGATGTCTCTCTTTTGAATCCCATTCTTGTCCATTGCAGGACTTCTGCAAAACCCTTTTATGCGATTATCCACAGAGTTACAGGTAGCATCATCATCGACTTTGAACCCGTCAAGCCTTATGAAGTCCCCATGACAGCCGCTGGTGCCTTACAATCATACAAGCTCGCTGCCAAAGCAATCACTAGGCTGCAATCTTTACCCAGCGGGAGTATGGAACGTCTTTGTGATACAATGGTTCAAGAGGTTTTTGAATTAACGGGGTATGACCGCGTTATGGCTTATAAGTTTCATGAAGATGACCACGGTGAGGTTGTCTCCGAGGTTACAAAACCTGGGCTGGAGCCTTATTTAGGTTTGCATTATCCTGCCACCGACATCCCTCAAGCAGCCAGATTTCTGTTTATGAAAAACAAGGTCCGGATGATAGTTGATTGCAATGCAAAACATGCTAGGGTACTTCAAGATGAAAAGCTTTCCTTTGACCTTACATTGTGTGGCTCCACCTTGAGAGCACCACACAGCTGCCATTTGCAGTACATGGCCAACATGGATTCAATTGCATCTCTGGTTATGGCCGTTGTAGTTAACGAGGAAGATGGTGAAGGTGATGCTCCTGATGCTACTACACAGCCTCAAAAGAGAAAGAGACTATGGGGTTTAGTAGTTTGTCACAATACGACTCCGAGATTTGTTCCATTTCCTCTCAGGTATGCCTGTGAGTTTCTAGCTCAAGTCTTTGCCATACACGTCAATAAGGAGGTTGAACTCGATAACCAGATGGTGGAGAAGAACATTTTGCGCACGCAAACACTCTTGTGCGATATGTTGATGCGTGATGCTCCATTAGGTATTGTGTCGCAAAGCCCCAATATAATGGACCTTGTGAAATGTGATGGAGCAGCTCTATTGTATAAAGACAAAATTTGGAAACTGGGAACAACTCCAAGTGAGTTCCACTTGCAGGAGATTGCTTCATGGTTGTGTGAATACCACATGGATTCAACGGGTTTGAGCACTGATAGTTTGCATGACGCCGGTTTTCCAAGAGCTCTATCTTTAGGGGATTCGGTATGTGGTATGGCAGCCGTGAGAATATCATCGAAAGACATGATTTTCTGGTTCCGTTCTCATACCGCTGGTGAAGTGAGATGGGGAGGTGCGAAACATGATCCAGACGATAGGGACGACGCAAGGAGAATGCACCCAAGGTCATCGTTCAAGGCTTTCCTTGAAGTCGTCAAGACAAGGAGTTTACCTTGGAAGGACTATGAGATGGATGCCATACACTCCTTGCAACTTATTTTGAGAAATGCTTTCAAGGATAGTGAAACTACTGATGTAAATACAAAGGTCATTTACTCGAAGCTAAATGATTTGAAAATTGATGGTATACAAGAACTAGAAGCTGTGACCAGTGAAATGGTTCGTTTAATTGAGACTGCTACGGTGCCAATATTGGCGGTTGATTCTGATGGACTGGTTAATGGTTGGAACACGAAAATTGCTGAGCTGACTGGTTTATCGGTTGATGAAGCAATCGGTAAACATTTCCTCACATTGGTTGAAGATTCTTCAGTGGAAATCGTTAAAAGAATGCTAGAAAACGCATTAGAAGGTACTGAAGAGCAAAATGTCCAGTTTGAAATAAAGACACATCTGTCCAGAGCTGATGCTGGTCCAATATCCTTAGTTGTAAATGCATGCGCAAGTAGAGATCTCCATGAAAACGTAGTTGGGGTGTGCTTTGTAGCCCATGATCTTACTGGCCAAAAAACTGTGATGGACAAATTTACGCGCATTGAAGGTGATTACAAGGCAATCATCCAAAATCCAAACCCGCTGATCCCGCCAATATTTGGTACCGATGAATTTGGATGGTGCACAGAATGGAATCCAGCAATGTCAAAATTAACCGGTTTGAAGCGAGAGGAAGTGATTGACAAAATGTTATTAGGTGAAGTATTTGGGACGCAGAAGTCATGTTGTCGTCTAAAGAATCAAGAAGCCTTTGTAAACTTAGGCATTGTGTTAAACAATGCTGTCACCTCCCAAGATCCAGAAAAAGTATCGTTTGCTTTCTTCACAAGAGGTGGCAAGTATGTGGAGTGTTTGTTGTGTGTTAGTAAAAAATTAGACAGGGAAGGTGTAGTTACAGGTGTCTTCTGTTTCCTACAATTAGCCTCTCATGAGCTTCAGCAAGCGTTGCATGTTCAACGTTTAGCCGAACGAACCGCAGTCAAGAGACTAAAGGCTCTAGCATACATAAAAAGACAGATCAGAAATCCGCTATCTGGGATTATGTTTACAAGAAAAATGATAGAAGGTACTGAATTAGGACCAGAGCAAAGAAGAATTTTGCAAACTTCCGCGTTATGTCAGAAGCAACTAAGCAAAATCTTAGATGACTCGGATCTTGAAAGCATCATTGAAGGATGCTTGGATTTGGAAATGAAAGAATTCACCTTAAATGAAGTGTTGACTGCTTCCACATCTCAAGTAATGATGAAGAGTAACGGAAAATCCGTTCGGATAACAAATGAGACCGGAGAAGAAGTAATGTCTGACACTTTGTATGGAGACAGTATTAGATTACAACAAGTCTTGGCAGACTTCATGCTGATGGCTGTAAACTTTACACCATCCGGTGGTCAGCTAACTGTTTCAGCTTCCTTGAGAAAAGACCAGTTGGGTCGTTCTGTGCATTTAGCTAATCTAGAGATTAGATTAACGCATACCGGCGCTGGCATACCTGAGTTTTTACTAAACCAAATGTTTGGAACTGAAGAAGATGTATCAGAAGAAGGTTTGTCTTTAATGGTTAGCCGAAAACTGGTGAAACTGATGAATGGAGATGTTCAGTACTTGAGACAAGCTGGGAAATCAAGTTTCATTATCACTGCGGAATTAGCTGCAGCAAACAAGTAA


GAD-FHY1 fusion protein
GCGGAATTAATTCCCGAGCCTCCAAAAAAGAAGAGAAAGGTCGAATTGGGTACCGCCGCCAATTTTAATCAAAGTGGGAATATTGCTGATAGCTCATTGTCCTTCACTTTCACTAACAGTAGCAACGGTCCGAACCTCATAACAACTCAAACAAATTCTCAAGCGCTTTCACAACCAATTGCCTCCTCTAACGTTCATGATAACTTCATGAATAATGAAATCACGGCTAGTAAAATTGATGATGGTAATAATTCAAAACCACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGCGTTTGGAATCACTACAGGGATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATTCGATGATGAAGATACCCCACCAAACCCAAAAAAAGAGATCTTTAATACGACTCACTATAGGGCGAGCGCCGCCATGGAGTACCCATACGACGTACCAGATTACGCTATGCCTGAAGTAGAAGTGGATAACAACAACGAGAAGCCAAGTGAGATTAATTCCTTCCATCACATGATCATAAGTAGTAGTAAAAATGTGTTGAAAATGGAAGAAGTTGAAGTTAGCAAGAAGAGGAAATTTCAAACGGATCAATCTGATGAGTTATCGTTACTTCCACTGTCAAAACACACTTGTTTTGCCAATGTTGCGTGTTCGGAGAATACAAATGGTAATTCGGAGATAGATACAGAATACTCAATGTCTTCTTATGTCAATTCAACCACTTCTATGGAGTGCAACAATGATATAGAAATGAAAGAAGAATCCTCTGGTTCATGCGGTGAAGACAAAATGATCTCTTTCGAAAGCCATTTGGATTACATCTATGGCACTCAGAACTTAGAGGACTTTTCAGAGAAAGTCATTGAAAACATTTTGTATCTCGACGAACAAGAAGAAGAAGAAGAAGACGCTAAAGGGTGTAGTTCCAATGCAGCTAAGTTTGTACTTTCCTCTGGAAGATGGACCGTTAACCAAGACGATAGCACTTTGCATGAGACAAAGAAGCCCACCATTGATCAGGAATTTGAACAATACTTCTCAACGCTAATGTTGTAA


ADH1 promoter+truncated ADH1 promoter
GGAGTTGATTGTATGCTTGGTATAGCTTGAAATATTGTGCAGAAAAAGAAACAAGGAAGAAAGGGAACGAGAACAATGACGAGGAAACAAAAGATTAATAATTGCAGGTCTATTTATACTTGATAGCAAGACAGCAAACTTTTTTTTATTTCAAATTCAAGTAACTGGAAGGAAGGCCGTATACCGTTGCTCATTAGAGAGTAGTGTGCGTGAATGAAGGAAGGAAAAAGTTTCGTGTGCTTCGAGATACCCCTCATCAGCTCTGGAACAACGACATCTGTTGGTGCTGTCTTTGTCGTTAATTTTTTCCTTTAGTGTCTTCCATCATTTTTTTGTCATTGCGGATATGGTGAGACAACAACGGGGGAGAGAGAAAAGAAAAAAAAAGAAAAGAAGTTGCATGCGCCTATTATTACTTCAATAGATGGCAAATGGAAAAAGGGTAGTGAAACTTCGATATGATGATGGCTATCAAGTCTAGGGCTACAGTATTAGTTCGTTATGTACCACCATCAATGAGGCAGTGTAATTGGTGTAGTCTTGTTTAGCCCATTATGTCTTGTCTGGTATCTGTTCTATTGTATATCTCCCCTCCGCCACCTACATGTTAGGGAGACCAACGAAGGTATTATAGGAATCCCGATGTATGGGTTTGGTTGCCAGAAAAGAGGAAGTCCATATTGTACACCCGGAAACAACAAAAGGTTCCTCCAGGTCGAGATCCGGGATCGAAGAAATGATGGTAAATGAAATAGGAAATCAAGGAGCATGAAGGCAAAAGACAAATATAAGGGTCGAACGAAAAATAAAGTGAAAAGTGTTGATATGATGTATTTGGCTTTGCGGCGCCGAAAAAACGAGTTTACGCAATTGCACAATCATGCTGACTCTGTGGCGGACCCGCGCTCTTGCCGGCCCGGCGATAACGCTGGGCGTGAGGCTGTGCCCGGCGGAGTTTTTTGCGCCTGCATTTTCCAAGGTTTACCCTGCGCTAAGGGGCGAGATTGGAGAAGCAATAAGAATGCCGGTTGGGGTTGCGATGATGACGACCACGACAACTGGTGTCATTATTTAAGTTGCCGAAAGAACCTGAGTGCATTTGCAACATGAGTATACTAGAAGAATGAGCCAAGACTTGCGAGACGCGAGTTTGCCGGTGGTGCGAACAATAGAGCGACCATGACCTTGAAGGTGAGACGCGCATAACCGCTAGAGTACTTTGAAGAGGAAACAGCAATAGGGTTGCTACCAGTATAAATAGACAGGTACATACAACACTGGAAATGGTTGTCTGTTTGAGTACGCTTTCAATTCATTTGGGTGTGCACTTTATTATGTTACAATATGGAAGGGAACTTTACACTTCTCCTATGCACATATATTAATTAAAGTCCAATGCTAGTAGAGAAGGGGGGTAACACCCCTCCGCGCTCTTTTCCGATTTTTTTCTAAACCGTGGAATATTTCGGATATCCTTTTGTTGTTTCCGGGTGTACAATATGGACTTCCTCTTTTCTGGCAACCAAACCCATACATCGGGATTCCTATAATACCTTCGTTGGTCTCCCTAACATGTAGGTGGCGGAGGGGAGATATACAATAGAACAGATACCAGACAAGACATAATGGGCTAAACAAGACTACACCAATTACACTGCCTCATTGATGGTGGTACATAACGAACTAATACTGTAGCCCTAGACTTGATAGCCATCATCATATCGAAGTTTCACTACCCTTTTTCCATTTGCCATCTATTGAAGTAATAATAGGCGCATGCAACTTCTTTTCTTTTTTTTTCTTTTCTCTCTCCCCCGTTGTTGTCTCACCATATCCGCAATGACAAAAAAATGATGGAAGACACTAAAGGAAAAAATTAACGACAAAGACAGCACCAACAGATGTCGTTGTTCCAGAGCTGATGAGGGGTATCTCGAAGCACACGAAACTTTTTCCTTCCTTCATTCACGCACACTACTCTCTAATGAGCAACGGTATACGGCCTTCCTTCCAGTTACTTGAATTTGAAATAAAAAAAAGTTTGCTGTCTTGCTATCAAGTATAAATAGACCTGCAATTATTAATCTTTTGTTTCCTCGTCATTGTTCTCGTTCCCTTTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCTATACCAAGCATACAATCAACTCCA


ADH1 terminator
AGCTTTGGACTTCTTCGCCAGAGGTTTGGTCAAGTCTCCAATCAAGGTTGTCGGCTTGTCTACCTTGCCAGAAATTTACGAAAAGATGGAAAAGGGTCAAATCGTTGGTAGATACGTTGTTGACACTTCTAAATAAGCGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTTATTGACCACACCTCTACCGGCC


Limonene synthase
ATGCGTCGTTCAGCAAACTACCAACCTTCAATTTGGGACCACGATTTTTTGCAGTCATTGAATAGCAACTATACGGATGAAGCATACAAAAGACGAGCAGAAGAACTGAGGGGAAAAGTGAAGATAGCGATTAAGGATGTAATCGAGCCTCTGGATCAGTTGGACCTGATTGATAACTTGCAAAGACTTGGATTGGCTCATCGTTTTGAGACTGAGATTAGGAACATATTGAATAATATCTACAACAATAATAAAGATTATAATTGGAGAAAAGAAAATCTGTATGCAACCTCCCTTGAGTTTAGACTACTTAGACAACATGGCTATCCTGTTTCTCAAGAGGTTTTCAATGGTTTTAAAGACGACCAGGGAGGCTTCATTTGTGATGATTTCAAGGGAATACTGAGCTTGCATGAAGCTTCGTATTACAGCTTAGAAGGAGAAAGCATCATGGAGGAGGCCTGGCAATTTACCAGCAAACATCTTAAAGAAGTGATGATCAGCAAGAACATGGAAGAGGATGTATTTGTAGCAGAACAAGCGAAGCGTGCACTGGAACTGCCTCTGCATTGGAAAGTGCCAATGTTAGAGGCAAGGTGGTTCATACACATTTATGAGAGAAGAGAGGACAAGAACCACCTTTTACTTGAACTGGCTAAGATGGAGTTTAACACTTTGCAGGCAATTTACCAGGAAGAACTAAAAGAAATTTCAGGGTGGTGGAAGGATACAGGTCTTGGAGAGAAATTGAGCTTTGCGAGGAACAGGTTGGTAGCGTCCTTCTTATGGAGCATGGGGATCGCGTTTGAGCCTCAATTCGCCTATTGTCGGAGAGTGCTCACAATCTCGATAGCCCTAATTACAGTGATTGATGACATTTATGATGTCTATGGAACATTGGATGAACTTGAGATATTCACTGATGCTGTTGAGAGGTGGGACATCAATTATGCTTTGAAGCACCTTCCGGGCTATATGAAAATGTGTTTTCTTGCGCTTTACAACTTTGTTAATGAATTTGCTTATTACGTTCTCAAACAACAGGATTTTGATTTGCTTCTGAGCATAAAAAATGCATGGCTTGGCTTAATACAAGCCTACTTGGTGGAGGCGAAATGGTACCATAGCAAGTACACACCGAAACTGGAAGAATACTTGGAAAATGGATTGGTATCAATAACGGGCCCTTTAATTATAACGATTTCATATCTTTCTGGTACAAATCCAATCATTAAGAAGGAACTGGAATTTCTGGAAAGTAATCCAGATATAGTTCACTGGTCATCCAAGATTTTCCGTCTGCAAGATGATTTGGGAACTTCATCGGACGAGATACAGAGAGGGGATGTTCCGAAATCAATCCAGTGTTACATGCATGAAACTGGTGCCTCAGAGGAAGTTGCTCGTCAACACATCAAGGATATGATGAGACAGATGTGGAAGAAGGTGAATGCATACACAGCCGATAAAGACTCTCCCTTGACTGGAACAACTACTGAGTTCCTCTTGAATCTTGTGAGAATGTCCCATTTTATGTATCTACATGGAGATGGGCATGGTGTTCAAAACCAAGAGACTATCGATGTCGGTTTTACATTGCTTTTTCAGCCCATTCCCTTGGAGGACAAACACATGGCTTTCACAGCATCTCCTGGCACCAAAGGCACCGGCGCTTGGTCACACCCGCAGTTCGAAAAATAA


GAL1/10 bidirectional promoter
GTTTTTTCTCCTTGACGTTAAAGTATAGAGGTATATTAACAATTTTTTGTTGATACTTTTATTACATTTGAATAAGAAGTAATACAAACCGAAAATGTTGAAAGTATTAGTTAAAGTGGTTATGCAGTTTTTGCATTTATATATCTGTTAATAGATCAAAAATCATCGCTTCGCTGATTAATTACCCCAGAAATAAGGCTAAAAAACTAATCGCATTATCATCCTATGGTTGTTAATTTGATTCGTTCATTTGAAGGTTTGTGGGGCCAGGTTACTGCCAATTTTTCCTCTTCATAACCATAAAAGCTAGTATTGTAGAATCTTTATTGTTCGGAGCAGTGCGGCGCGAGGCACATCTGCGTTTCAGGAACGCGACCGGTGAAGACGAGGACGCACGGAGGAGAGTCTTCCTTCGGAGGGCTGTCACCCGCTCGGCGGCTTCTAATCCGTACTTCAATATAGCAATGAGCAGTTAAGCGTATTACTGAAAGTTCCAAAGAGAAGGTTTTTTTAGGCTAAGATAATGGGGCTCTTTACATTTCCACAACATATAAGTAAGATTAGATATGGATATGTATATGGATATGTATATGGTGGTAATGCCATGTAATATGATTATTAAACTTCTTTGCGTCCATCCAAAAAAAAAGTAAGAATTTTTGAAAATTC


PGK terminator
ATTGAATTGAATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTCCCCATCCTTTACGCTAAAATAATAGTTTATTTTATTTTTTGAATATTTTTTATTTATATACGTATATATAGACTATTATTTATCTTTTAATGATTATTAAGATTTTTATTAAAAAAAAATTCGCTCCTCTTTTAATGCCTTTATGCAGTTTTTTTTTCCCATTCGATATTTCTATGTTCGGGTTCAGCGTATTTTAAGTTTA


YPRCtau3 up homologous sequence
AAAGGAGGTGCACGCATTATGGAGAaCACTACGATACGATAGCTGCGTTGTTGTTGAAGGGGTTTCTTAAGGTTGTTTTCGTTGAAGGTAAATATTGGTCGTTTTTGTGCAGCATATTGTCCTCAAGATGCAAACTCTGCAGGTCCATTTGCAGTAAAGTGAGTTGCCTCTCGAAGAATCATTAATTTCGTATAACCGTCACTATTAAAGTCAGAAAATAAATTCTGTCGTAGACAATGTTACCATAATGTTCTTGTCCATTTTGCATACACTTTAAATATTCATTTGATTTCTCAGGGTTCATGATCATAATAAATTGCGCATTCGCAAGGCGGTAGTATTATAATGGGGTCCATCATTCTGTAGCAAGAAGTTACAGTACGCTGTTCAAGCGTTAAACAAGATAAGTAATCTCGAATGAAACATTCATATTTCGCATGAGCCAACATACAGTTGCTGAGTAATCTTCATTGCGCTTATTTATCGGCATTGAGATTGTAAAGGAAGTAAAACGCATTTTTGCAGATCTGTTCTCTTATGTATTTTTAATCGTCCTTGTATGGAAGTATCAAAGGGGACGTTCTTCACCTCCTTGGAA


YPRCtau3 down homologous sequence
GATGGGACGTCAGCACTGTACTTGTTTTTGCGACTAGATTGTAAATCATTCTTTATTTAATCTCTTTCTTTAACTACTGCTTAAAGTATAATTTGGTCCGTAGTTTAATAACTATACTAAGCGTAACAATGCATACTGACATTATAAGCCTGAACATTACGAGTTTAAGTTGTATGTAGGCGTTCTGTAAGAGGTTACTGCGTAAATTATCAACGAATGCATTGGTGTATTTGCGAAAGCTACTTCTTTTAACAAGTATTTACATAAGAATAATGGTGATCTGCTCAACTGATTTGGTGATAACTCTAACTTTTTTAGCAACAATTTAAAAGATAATTCGAACATATATAACAGTAGGAAGAATTTGTGTACGTCAAATTAAGATAATTTAGCATTACCAAAGTTATTAACCTAAACATAAAATATATATGAGACACATGTGGAAATCGTATGAAACAACTGTTATGAAACTGACAAGAATGAATATATAGAGTAAGCTCCGCTTGTAAAGAGGAATCACTTAAGTGTATAAATGTCTCGACGATTACTTTAGATCCAAGATTGATGATTGATATTACTCTGTAATACTTAAGCTCTTTTAATAGCTCACTGTTGTATTACGGGCTCGAGTAATACCG


Yeast CENPK1137 genome


This yeast strain was used to obtain the MET17 auxotrophic marker and TDH1 promoter.


Biological materials and tools


Microbial strains


Saccharomyces cerevisiae

BY4741: MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0

BY4741 ∆GAL4: MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 GAL4∆0

CENPK3711: MATa/α ura3-52/ura3-52 trp1-289/trp1-289 leu2-3,112/leu2-3,112 his3 Δ1/his3 Δ1 MAL2-8C/MAL2-8C SUC2/SUC2

E.coli

  • E.coli Stellar: F–, endA1, supE44, thi-1, recA1, relA1, gyrA96, phoA, Φ80d lacZΔ M15, Δ(lacZYA-argF) U169, Δ(mrr-hsdRMS-mcrBC), ΔmcrA, λ–

Clostridium ljungdahlii


Media

    YPD

  • Dissolve 10 g of BactoYeast extract in 500 mL water.
  • Dissolve 20 g of BactoPeptone in the above solution.
  • Dissolve 20 g Dextrose in the above solution.
  • q.s. to 1000 mL with water.
  • Autoclave.


    YNB - Y 1250 (Sigma, Germany)

  • Dissolve 6.8 g in 1000 mL of water.
  • Autoclave.


    LB

  • Dissolve 5 g of yeast extract in 500 mL water.
  • Dissolve 10 g peptone from casein in the above solution.
  • Dissolve 10 g sodium chloride in the above solution.
  • q.s. to 1000 mL with water.
  • Autoclave.


    LB-agar

  • Dissolve 5 g of yeast extract in 500 mL water.
  • Dissolve 10 g peptone from casein in the above solution.
  • Dissolve 10 g sodium chloride in the above solution.
  • Dissolve 12 g agar-agar in the above solution.
  • q.s. to 1000 mL with water.
  • Autoclave.



    LB

  • Dissolve 5 g of yeast extract in 500 mL water.
  • Dissolve 10 g peptone from casein in the above solution.
  • Dissolve 10 g sodium chloride in the above solution.
  • q.s. to 1000 mL with water.
  • Autoclave.


Electrophoresis gel 1%:
1 g of Agarose (A9539) per 100 mL of TAE (0.5X).


Electrolyzer

The Electrolyzer 65 is Double-Cell PEM electrolyzer stackfrom FuelCell Store, for production of hydrogen from distilled water. The center of the cell houses the hydrogen side of the two individual cells. The two outer sides of the cell have the function of supplying water and removing the oxygen produced. The two individual cells are connected electrically in series. Both cells have an electrode area of 16cm2.

    Specifications:

  • Hydrogen Production Rate: 65 cm3/min
  • Oxygen Production Rate: 32.5 cm3/min
  • Hydrogen Storage Volume: 80 cm3/min
  • Oxygen Storage Volume: 40 cm3/min
  • Power Consumption: 16 Watts at 4.0 VDC
  • Permissible Operating Voltage: 0 - 4 VDC
  • Permissible Operating Current: 0 - 4.4 A
  • Permissible Operating Pressure: 0 - 5 mbar
  • Electrode Area: 2 cells at 16cm2 each
  • Operating Medium: Distilled Water
  • Dimensions (H x W x D): 9.9" x 9.9" x 4.7" (250 x 250 x 120 mm)
  • Weight: 2.1 pounds (950 g)

    • Yeast modifications protocols


    Cloning's methods


    Digestion and DNA purification


    1. Enzymatic plasmid digestion

    • CutSmart Buffer 2 µl
    • DNA (pUC19) 1 µl
    • Enzyme 0.5 µl
    • Water 16.5 µl
    • 2h incubation at 37 °C


    2. DNA purification
    Materials

    • DNA fragment previously digested
    • Table-top microcentrifuge.
    • Sodium Acetate 3 M.
    • Ethanol 90%.
    • 1.5 mL microcentrifuge tube.
    • Nuclease free-water.
    • Freezer at -80 °C.


    Methods

    1. Add twice the DNA volume of phenol, and vortex for 1 min.
    2. Centrifuge at 13000rpm for 5 min.
    3. Take 180 µL from the phase on top.
    4. Add 0.1x of Sodium Acetate 3 M and 3x of Ethanol.
    5. Mix immediately and thoroughly by inverting the tube 20 times.
    6. Incubate at -80 °C for 4 h 30 min to precipitate DNA.
    7. Centrifuge 15 min at 14,000rpm.
    8. Remove the pellet.
    9. Centrifuge 1 min at 14,000rpm.
    10. Remove the pellet.
    11. Incubate at room temperature for 5 min.
    12. Resuspend pellet with 5 µL of nuclease-free water.


    3. Gel verification
    Agarose gel migration at 100V during 25 min using Gel Loading Dye, Purple (6X) by NEB, and 1kb plus ladder as molecular weight marker by NEB.


    Gel extraction

    Agarose gel migration at 50 V during 60 min using Gel Loading Dye, Purple (6X) by NEB, and 1kb plus ladder as molecular weight marker by NEB.

    Different kits were used to purify DNA from gel.

    1. Monarch® DNA Gel Extraction Kit
    We used the Monarch® DNA Gel Extraction Kit by NEB to purify DNA.


    Material

    Methods

    1. Excise the DNA fragment from the agarose gel, taking care to trim excess agarose. Transfer to a 1.5 mL microfuge tube, and weigh the gel slice.
    2. Add 4 volumes of Gel Dissolving Buffer to the gel slice.
    3. Incubate the sample between 50 °C, vortexing periodically until the gel slice is completely dissolved (10 minutes).
    4. Insert column into collection tube and load sample onto the column. Spin for 1 minute, then discard flow-through.
    5. Re-insert column into collection tube. Add 200 μl DNA Wash Buffer and spin for 1 minute. Discarding flow-through is optional.
    6. Repeat step 5.
    7. Transfer column to a clean 1.5 mL microfuge tube. Use care to ensure that the tip of the column does not come into contact with the flow-through.
    8. Add 25μl of milliQ water to the center of the matrix. Wait for 1 minute, and spin for 1 minute to elute DNA.


    2. NucleoSpin-Gel-and-PCR-Clean-up

    We also used the NucleoSpin-Gel-and-PCR-Clean-up kit by NucleoSpin.

    Materials

    Methods

    1. Excise DNA fragment and solubilize gel slice in twice the weighted volume with NT1.
    2. Incubate 10 min at 50 °C.
    3. Centrifuge 30s at 11,000 g.
    4. Add 700 µL of NT3, and centrifuge 30s at 11000 g.
    5. Repeat step 4.
    6. Centrifuge 1 min at 11000 g.

    7. Add 20 µL of milliQ water, wait for 2 min at room temperature.


    DNA extraction


    1. QIAprep® Spin Miniprep Kit
    We followed the QIAprep® Spin Miniprep Kit to extract DNA.

    Materials

    • 5 mL bacterial overnight culture
    • QIAprep® Spin Miniprep Kit buffers
    • 1.5 mL microcentrifuge tubes
    • Table-top microcentrifuge


    Procedure

    1. Pellet 5 mL bacterial overnight culture by centrifugation at 6800 x g for 3 min at room temperature.
    2. Resuspend pelleted bacterial cells in 250 μl Buffer P1 and transfer to a 1.5 mL microcentrifuge tube.
    3. Add 250 μl Buffer P2 and mix thoroughly by inverting the tube 6 times until the solution becomes clear. Do not allow the lysis reaction to proceed for more than 5 min.
    4. Add 350 μl Buffer N3 and mix immediately and thoroughly by inverting the tube 6 times.
    5. Centrifuge for 10 min at 17,900 x g in a table-top microcentrifuge.


    2. QIAprep® Plasmid Midiprep kit

    We used the QIAGEN Plasmid midi kit to extract DNA from our intermediary clones before being inserted to the yeast.


    Materials

    Procedure

    1. Harvest overnight bacterial culture by centrifuging at 6000 x g for 15 min at 4 °C
    2. Resuspend pellet in 4 mL of buffer P1.
    3. Add 4 mL of buffer P2 mix thoroughly by vigorously inverting 6 times and incubate at room temperature (25 °C) for 5 min.
    4. Add 4 mL of prechilled buffer P3 mix thoroughly by vigorously inverting 6 times.
    5. Incubate on ice for 15 min.
    6. Centrifuge at 4,000 x g for 60 min at 4 °C. Re-centrifuge the supernatant at 4,000 x g for 30 min at 4 °C.
    7. Equilibrate a QIAGEN-tip with 4 mL Buffer QBT and let it flow through the column.
    8. Apply the supernatant from step 6 to the QIAGEN-tip and allow it to enter the resin by gravity flow.
    9. Wash the QIAGEN-tip with 10 mL buffer QC, let it flow through the column and repeat this step.
    10. Elute DNA with 5 mL Buffer QF into a 15 mL falcon tube.
    11. Add 3.5 mL of roomtemperature isopropanol to the eluted DNA and mix to precipitate DNA. Centrifuge at 4,000 x g for 60 min at 4 °C. Carefully decant the supernatant.
    12. Wash the DNA pellet with 2 mL room-temperature 70% ethanol and centrifuge at 4,000 x g for 20 min. Carefully decant supernatant.
    13. Air-dry pellet for 10 min and redissolve DNA in 100 µL of nuclease-free water.


    PCR

    1. PCR amplification
    We used CloneAmp HiFi PCR Premix.


    Materials

    • PCR thermocycler
    • PCR tubes
    • Primers (both forward and reverse)
    • Template DNA
    • CloneAmp HiFi PCR Premix


    Procedure
    Keep each of the reaction components on ice during the preparation. All components should be mixed and briefly centrifuged.

    Mix the master mix by tapping then centrifuge briefly the mix.


    2. PCR purification
    We used QIAquick PCR Purification Kit to purify our DNA from PCR.


    Materials

    • Binding buffer(PB)
    • Washing buffer (PE)
    • Elution buffer (EB)
    • pH indicator I
    • 3 M sodium acetate
    • 2 mL collection tube
    • QIAquick column
    • 1.5 mL microcentrifuge tube
    • 96-100 % ethanol
    • Microcentrifuge capable of achieving 17,900 x g


    Procedure

    1. Before starting. Add ethanol to Buffer PE and 1:250 volume pH indicator I to Buffer PB.
    2. Binding DNA.
    3. Add 5 volumes Buffer PB to 1 volume of the PCR reaction and mix. If the color of the mixture is violet or orange add 10 µL 3 M sodium acetate.
    4. Place the QIAquick column in a 2 mL collection tube.
    5. Apply the sample to the QIAquick column and centrifuge at 17,900 x g for 60 sec.
    6. Washing DNA.
    7. Add 750 µL of Buffer PE and centrifuge at 17,900 x g for 60 sec.
    8. Centrifuge once more at 17,900 x g for 60 sec.
    9. Place the QIAquick column in a 1.5 mL microcentrifuge tube.
    10. Eluting DNA.
    11. Add 30 µL Buffer EB to the center of the QIAquick membrane.
    12. Wait at room temperature for 1 min.
    13. Centrifuge at 17,900 x g for 1 min.


    3. Taq polymerase
    We used TaKaRa Taq DNA polymerase to verify the presence of DNA fragments (mainly for construction or integration validation).


    Materials

    • PCR thermocycler
    • PCR tubes
    • Primers (both forward and reverse)
    • Template DNA
    • dNTP Mixture
    • 10X PCR Buffer


    Procedure

    1. We recommend keeping the components on ice while preparing the mix.

    Notes: Gently mix the reaction.

    1. Transfer PCR tubes into a thermal cycler.

    4. Genomic PCR for verification
    We used the TAKARA PCR mix to verify our yeast transformation.


    Materials

    Method

    1. Add 10 µL of 0.02 M NaOH in a 0.2 mL PCR tube.
    2. Add a yeast fresh transformed colony in the 0.2 mL PCR tube.
    3. Gently mix.
    4. Incubate 5 min at 95 °C, then incubate on ice until used.
    5. Prepare the PCR mix (in a total volume of 50 µL):

    1. Add 2 µL of the yeast to the mix

    2. Place the tubes in a thermal cycler, and execute the following program:


    Cloning

    1. In-Fusion
    Materials

    1. Insert: PCR Fragment purified (ClonAMP®)
    2. Vector: Linearized plasmid purified (Cutsmart®)
    3. In-Fusion® cloning kit Takara
    4. PCR Thermocycler


    Methods

    2. Ligation (T4 DNA ligation)
    We used the T4 DNA ligase by NEB to ligate our vector and insert.


    Material

    • DNA vector
    • DNA insert
    • T4 DNA ligase buffer
    • T4 DNA ligase
    • nuclease free water
    • 65 °C warm bath
    • 1.5 mL microcentrifuge tube
    • thermocycler


    Methods

    1. Set up the following reaction in a microcentrifuge tube on ice (molar ratio of 1:3)
    2. Gently mix the reaction by pipetting up and down and microfuge briefly.
    3. For cohesive (sticky) ends, incubate at 16 °C overnight.
    4. Heat inactivate at 65 °C for 10 minutes.
    5. Chill on ice and transform 5 μl of the reaction into 50 μl competent cells.

    A control is performed by adding nuclease-free water instead of the insert.


    Transformation methods


    1. E. coli stellar transformation
    We used StellarTM Competent Cells Protocol (PT5055-2) from ClonTech

    Materials

    • Plasmids (given to us)
    • Stellar Competent Cells
    • 14 mL round-bottom tube
    • SOC medium
    • Selective medium on plates
    • 37 °C incubator
    • 42 °C water bath


    Procedure

    1. Thaw Stellar Competent Cells in an ice bath and then move 50 μl of competent cells into a 14-mL round-bottom tube.
    2. Add 5 ng of DNA for transformation.
    3. Place tubes on ice for 30 min.
    4. Heat shock the cells for exactly 45 sec at 42 °C in a water bath.
    5. Place tubes on ice for 1–2 min.
    6. Add 450 μl of SOC medium.
    7. Incubate by shaking for 1 hr at 37 °C.
    8. Plate an appropriate amount of culture on a selective medium (ampicillin for pRS313, pRS315, pFL36, pFL38, L-83, L-105 and pENZ-047, and Kanamycin for pMRI34 and pHR0016)
    9. Incubate overnight at 37 °C.


    2. Yeast

    2.1 Yeast competent cells

    Materials
    • 75 mL of YPD medium.
    • 50 mL falcon-tube.
    • Centrifuge
    • 26 mL of LiAc/TE.


    Methods

    1. Overnight preculture from a fresh colony of yeast in 25 mL of YPD.
    2. Dilute overnight precultures to low OD600 (e.g. 0.05) in 50 mL fresh YPD medium.
    3. Mesure concentration every 2h to 3h until it reaches an OD of around 0.8.
    4. Transfer 50 mL to a 50 mL falcon-tube and centrifuge 5 min at 3000rpm (room-temperature).
    5. Remove flow-thru and add 25 mL of LiAc/TE, mix thoroughly by inverting the tube 10 times.
    6. Centrifuge 5 min at 3000rpm (at room-temperature).
    7. Remove flow-thru.
    8. Add 400 µL of LiAc/TE, mix thoroughly by inverting the tube 10 times.

    Yeast competent cells should be used on the same day that they have been prepared.


    2.2 Yeast transformation

    Materials

    • Transforming DNA
    • Competent yeast cells
    • 10 mg/mL carrier DNA (SS-DNA)
    • 50% PEG in 100mM LiAc/TE
    • NaCl
    • YNB plates (with all the amino acids except for the amino acid corresponding to the selectable marker)
    • 30 °C warm bath
    • 42 °C warm bath
    • 30 °C incubator
    • table-top microcentrifuge
    • 1.5 mL microcentrifuge tube


    Method

    1. Prepare mix in 1.5 mL microcentrifuge tube:

    Positive control was performed by adding 1 µL of pR313 instead of the transforming DNA, and negative control had no DNA.

    1. Vortex solution.
    2. Incubate 45 min at 30 °C.
    3. Add 13 µL of DMS0 and vortex solution.
    4. Incubate 15 min at 42 °C.
    5. Add 450 µL of NaCl and vortex solution.
    6. Centrifuge at 10,000 rpm for 1 min.
    7. Remove flowthru and resuspend pellet with 80 µL of NaCl.
    8. Plate solution on YNB plates (with all the amino acids except for the amino acid corresponding to the selectable marker)
    9. Incubate at 30 °C for two to three days.


    GGPP extraction and quantification by LC/MS


    Sampling and Sample preparation
    GGPP was sampled by fast filtration. The cells transformed with our insert containing tHMG1 and CrtE and the wild type were grown on YNB + 2% Glucose. 10 mL of broth were filtered through 0.45 µm Sartolon polyamide (Sartorius, Goettingen, Germany) and washed with 5 mL of YNB with leucine, methionine and uracile. The filters were rapidly plunged into liquid nitrogen and then stored at −80 °C until extraction. Intracellular metabolites were extracted by incubating filters in closed glass tubes containing 5 mL of an isopropanol/H20 NH4HCO3 100 mM (50/50) mixture at 70 °C for 10 min. Cellular extracts were cooled on ice and sonicated during 1 min. Cell debris was removed by centrifugation (5000×g, 4 °C, 5 min). Supernatants were evaporated overnight (SC110A SpeedVac Plus, ThermoFisher, Waltham, MA, USA), resuspended in 200 μL of methanol: NH4OH 10 mM (7:3) at pH 9.5 and stored at − 80 °C until analysis.


    LC-MS analyses of GGPP
    Analyses were carried out on a LC–MS platform composed of a Thermo Scientific™ Vanquish™ Focused UHPLC Plus system with DAD, coupled to a Thermo Scientific™ Q Exactive™ Plus hybrid quadrupole-Orbitrap™ mass spectrometer (ThermoFisher).

    Analysis of GGPP was performed on a Thermo Scientific™ Hypersil C18 GOLD™, 3 µm, and 2.1 × 100 mm column. The column was kept at 25 °C and the flow rate was set to 0.3 mL/min during the first 2 min and 0.4 mL/min for the rest of the chromatographic run. The solvent system consisted of (A) 20 mM NH4FA, pH 9.5, in water and (B) 20 mM NH4FA, pH 9.5, in 9:1 (v/v) acetonitrile–water, with the following gradient: 0–12 min from 100% A to 100% B, 5.5 min kept with 100% B and within 0.5 min the return to the initial condition and 4 min equilibration of the column. The injection volume was 10 µL.

    Mass detection was carried out in a negative electrospray ionization (ESI) mode. The settings of the mass spectrometer were as follows: spray voltage 3.2 kV, capillary and desolvation temperature were 350 and 400 °C respectively, maximum injection time 200 ms. Nitrogen was used as sheath gas (50 a.u.) and auxiliary gas (15 a.u.). The automatic gain control (AGC) was set at 106 and resolution at 70,000 from m/z 100 to 700. MS analyses were performed bytargeted selected ion monitoring (tSIM) mode with 0.5 m/z isolation window for SIM and ±10 ppm for inclusion tolerances. tSIM MS scans the targeted masses in different time segments selected based on the retention times of the analytes. Data acquisition was performed using Thermo Scientific Xcalibur software. Calibration standards (prepared at concentrations from 0.08 nM to 10 µM) were used to construct calibration curves enabling to determine the concentration of each compound in the samples to be measured.


    Reference
    Sara Castaño‑Cerezo, Hanna Kulyk‑Barbier, Pierre Millard, Jean‑Charles Portais, Stéphanie Heux, Gilles Truan, Floriant Bellvert, 2019. Functional analysis of isoprenoid precursors biosynthesis by quantitative metabolomics and isotopologue profiling. Metabolomics (2019) 15:115

    https://doi.org/10.1007/s11306-019-1580-8


    Geraniol HPLC analysis


    Geraniol was quantified by High-Pressure Liquid Chromatography (HPLC), using a 1220 Infinity II LC system (Agilent, Germany). Separation was carried out with a Synergi 4 µm Fusion-RP C18 Å 250x4.6 mm column (Phenomenex) column at 30 °C, with a flow rate of 1 mL/min, using a linear gradient starting from 30 % acetonitrile / 70 % H2O up to 100 % acetonitrile at 30 minutes. Geraniol was detected by UV at 200 nm. Two peaks corresponding to cis- and trans-geraniol were detected at 16.5 and 17 minutes. The injection volume was 20 µL. Standard mixtures (at concentration from 0.05 to 0.5 mM) were used to construct calibration curves (Fig. 1).

    Figure 1. Geraniol calibration curve.Two peaks corresponding to cis- and trans-geraniol were detected at 16.5 and 17 minutes.


    Fermentation protocols for the coculture system


    Medium for the coculture between Clostridium ljungdahlii and Saccharomyces cerevisiae.


    Medium and conditions
    The range of temperature for the yeast is [25;37] °C and the range of temperature for the bacteria is [30;40] °C. This is why we fixed the coculture temperature at 33 °C. The optimal pH of S. cerevisiae is 5.5 and C. ljungdahlii can grow at this pH.

    We elaborated a medium for the coculture based on the media used for Clostridium ljungdahlii and Saccharomyces cerevisiae [1],[2]. To design it we receive help from Jason M. Whitham. All the compounds used in S. cerevisiae media are approximately in the same quantity in the media used for C. ljungdahlii. The medium is therefore composed of YNB (what the yeast needs) and we added everything else the bacteria needs. Here is how we elaborated the first coculture medium:

    Dissolve ingredients of the pre-medium, warm the solution if necessary to dissolve YNB. Add 10 mL of the trace element solution which should be at pH=4. Sparge medium with 80% N2 and 20% CO2 gas mixture for several minutes to make it anoxic and adjust pH to 5.5. Autoclave at 121 °C for 15 min. Add 10 mL of vitamins (sterilized by filtration) from sterile stock solutions prepared under 100% N2 gas atmosphere. Adjust pH of complete medium to 7 by adding the appropriate volume of NaOH (at 1 mM). Before yeast inoculation, be sure to have a pO2 at 5%.

    Growth experiments with S. cerevisiae
    We grew CENPK1137 cells at 33 °C, pH 5.5 and 150rpm as followed:

    1. pre-medium without Na2S + trace elements solution + 0.38% ethanol + 0.5% acetate
    2. pre-medium + trace elements solution + 0.38% ethanol + 0.5% acetate
    3. pre-medium without Na2S + trace elements solution + vitamins solution + 0.38% ethanol + 0.5% acetate


    Growth experiments with C. ljungdahlii
    We made all our C. ljungdahlii growths on the coculture medium as we describe it in the protocole “Growth experiments of Clostridium ljungdahlii”.


    References
    [1] 879. CLOSTRIDIUM LJUNGDAHLII MEDIUM
    https://www.dsmz.de/microorganisms/medium/pdf/DSMZ_Medium879.pdf

    [2] BD Difco™ Yeast Nitrogen Base without Amino Acids
    https://www.fishersci.com/shop/products/bd-difco-dehydrated-culture-media-yeast-nitrogen-base-without-amino-acids-6/p-4901538

    Growth experiments of Clostridium ljungdahlii


    Strain and conditions
    Clostridium ljungdahlii (Tanner et al. 1993) was obtained from DSMZ (https://www.dsmz.de/, Germany). Growth experiments were carried out in serum bottles filled with water, culture medium or other solutions. All bottles were sparged with nitrogen and/or carbon dioxide before autoclave to ensure anaerobic conditions.

    Figure 2. Serum bottles inoculated with Clostridium ljungdahlii

    Storage
    2.5 mL of 50% glycerol / 50% water solution were added in 10 mL serum bottles under a nitrogen atmosphere to ensure anaerobic conditions. Sterilization was performed by autoclave. We added 2.5 mL of an active culture in exponential growth phase on fructose (5 g/l), and serum bottles were stored at -80 °C.


    Medium preparation
    Dissolve ingredients of the pre-medium, warm the solution if necessary to dissolve YNB. Add 10 mL of the trace element solution which should be at pH=4. Sparge medium with 80% N2 and 20% CO2 gas mixture for several minutes to make it anoxic and adjust pH to 5.5. Autoclave at 121 °C for 15 min. Add 10 mL of vitamins (sterilized by filtration) from sterile stock solutions prepared under 100% N2 gas atmosphere. Adjust pH of complete medium to 7 by adding the appropriate volume of NaOH (at 1 mM).


    Experimental setup for growth of C. ljungdahlii on CO2 and H2
    Growth experiments of C. ljungdahlii on CO2 and H2 were performed using a tailor-made reactor of 300 mL with two heads. The stoppers have been made impermeable to gases with silicone. CO2 was provided from a gas bottle at a constant flow rate under approximately 2 bar pressure (Air Liquide, France) and H2 from a water electrolyzer (Electrolyzer 65, FuelCellStore, USA). We added a constant flow of nitrogen to reduce the risk of H2 accumulation and increase our safety. The set-up of the system is shown on figure 1.

    Figure 3: Scheme of the set-up for Clostridium ljungdahlii growth on CO2 and H2

    Figure 4: Set-up for Clostridium ljungdahlii growth on CO2 and H2

    We filled the reactor with 200 mL of culture medium (without fructose and vitamins) sparged with CO2 and N2. Vitamins were added after autoclave. The reactor was inoculated with 15 mL of an active C. ljungdahlii culture in mid-exponential growth phase (after 2 days of incubation). Growth was initially warried out at the optimal temperature of 37 °C (we will also try at 33 °C, i.e. the coculture temperature).

    Every two hours, 2 mL of broth were sampled. 1 mL was used for OD measurement at 600nm, using a Genesys spectrophotometer (Thermo Fisher, USA). The other milliliter was centrifuged 5 minutes at 13 000 rpm, and the supernatant was filtered and stored at -20 °C until analysis.

    References

    • Michael E. Martin, Hanno Richter, Surya Saha, Largus T. Angenent, 2016. Traits of Selected Clostridium Strains for Syngas Fermentation to Ethanol. Biotechnology and Bioengineering, Volume113, Issue3, March 2016, Pages 531-539. DOI 10.1002/bit.25827

    • Jason M. Whitham, Joel J. Pawlak, Amy M. Grunden, 2016. Clostridium ljungdahlii: A Review of the Development of an Industrial Biocatalyst. Current Biotechnology Volume 5 , Issue 1 , 2016. DOI: 10.2174/2211550105666151208211335

    Growth experiments of Saccharomyces cerevisiae


    Strain
    The strain used for the growth experiments was Saccharomyces cerevisiae CENPK3711.


    Medium and culture conditions
    S. cerevisiae was grown on YNB medium (Sigma) with different concentrations of ethanol and/or acetate as sole carbon source(s) (Figure 1). Temperature was set at 33 °C, which is appropriate to grow both yeast (growing at temperature between 25 and 37 °C) and bacteria is (30-40 °C).

    S. cerevisiae cells were inoculated on fresh petri dishes of YNB with 2 % of glucose, which was used to inoculate pre-cultures in glass tubes containing 5 mL of YNB with acetate and/or ethanol (150 rpm). After 24h, these pre-cultures were diluted 10 times serially in 4 tubes. The second pre-cultures were carried out in the same conditions for 24 h. Growth experiments were carried out in 500 mL shake flasks containing 50 mL of medium at 150 rpm. Three biological replicates were carried out for each experiment.

    Figure 5. Concentration of carbon sources (acetate and/or ethanol, expressed as weight percent) used to grow Saccharomyces cerevisiae on YNB in each experiment


    Sampling
    Every two hours, 2 mL of broth were sampled. 1 mL was used for OD measurement at 600nm, using a Genesys spectrophotometer (Thermo Fisher, USA). 1 mL was centrifuged 5 minutes at 13 000 rpm, and the supernatant was filtered and stored at -20 °C until HPLC analysis.


    Acetate and ethanol analysis


    HPLC analysis
    Ethanol and acetate were quantified by High-Pressure Liquid Chromatography (HPLC), using a UltiMate 3000 SD HPLC Dionex™ system (Thermo Scientific™). Separation was carried out with an Aminex HPX-87H 300 x 7.8 mm column (BioRad, France). Elution was carried out at 50 °C and a flow rate of 0.6 mL/min with an isocratic solution of 5 mM of H2SO4 as mobile phase. Detection was performed by refractometry with aSP6040 (Spectra-Physics) detector. The injection volume was 20 µL. Standard mixtures (at concentration from 0.5 to 20 g/L) were used to construct calibration curves (Figures 1 and 2). We used this method for the analysis of supernatant of yeast cultures.

    Figure 6. Acetate standard curve

    Figure 7. Ethanol standard curve.


    NMR analysis
    The extracellular medium of Clostridium ljungdahlii was analyzed by NMR to identify and quantify all the (protonated) compounds produced during growth on H2 and CO2. 180 µL of supernatant collected in mid-exponential growth phase were mixed with 20 µL of TSP-d4 (used as internal standard and spectrum reference) dissolved in D2O at a concentration of 10 mM, and introduced in a 3 mm tube. All NMR experiments were carried out on a Bruker Avance III spectrometer (Bruker, Germany) operating at 800 MHz proton frequency and equipped with a TCI cryogenic probe head. Temperature of the samples was 293 K. Spectra were processed with Bruker TopSpin 4.0.7.

    For the 1H 1D spectra, the standard Bruker pulse sequence noesypr1d for a 1D NOESY with water pre-saturation was used. Key parameters were as follows: spectral width 13 ppm/10417 Hz; complex points, TD 32768; interscan delay, d1 10 s; NOE mixing time, d8 100 ms; number of scans, ns = 32; dummy scans, ds = 4. Total experiment time was 25 minutes.

    For the 1H-1H 2D spectra, the standard Bruker pulse sequence dipsi2phpr for a 2D TOCSY with water pre-saturation was used. Key parameters were as follows: spectral width 13 ppm/10417 Hz in dimension F2 and 10 ppm/8012 Hz in dimension F1; complex points, TD 16384 in F2 and 128 in F1; interscan delay, d1 1 s; TOCSY mixing time, d9 60 ms. Total experiment time was 25 minutes.

    Only ethanol and acetate were detected in significant amounts (> 100 µM).


Go to Results


TBI Fondation Catalyseur CNES TWB Adisseo CBI Fondation INSA FSI INRAE

and many more. For futher information about our sponsors, please consult our Sponsors section on our Attribution page.

The content provided on this website is the fruit of the work of the Toulouse INSA-UPS iGEM Team. As a deliverable for the iGEM Competition, it falls under the Creative Commons Attribution 4.0. Thus, all content on this wiki is available under the Creative Commons Attribution 4.0 license (or any later version). For futher information, please consult the official website of Creative Commons.

This website was designed with Bootstrap (4.4.1). Bootstrap is a front-end library of component for html, css and javascript. It relies on both Popper and jQuery. For further information, please consult the official website of Bootstrap.