Team:PYMS GZ China/Model


Modeling
Overview

We performed a structural modeling analysis on an interaction between S protein of SARS-CoV-2 and ACE2 using wild type 614D and 614G variant. We engineered a pseudovirus assay expressing S and D614G variants and a dual GFP-luciferase reporter system. We show a dose dependent infection curve and higher infectivity by G614D variant, and further assessed the ability of neutralization of infection by antibodies from a monkey serum sample vaccinated by an RBD vaccine. We found that antibodies effectively block the interactions between the RBD of S protein and the ACE2 receptors of the original S strain as well as the predominant strain D614G, suggesting a vaccine made against original Wuhan virus can be effective against the mutated, more infectious G614D strain. Our engineered pseodoviruse system which provides a universal platform for infectivity and immunity evaluation on SARS-CoV-2.

Objectives

  1. Modeling an RBD-ACE2 interaction using public crystal structure data
  2. Engineer a pseudovirus
  3. Engineer a higher transfection efficacy of S protein
  4. Engineering a pseudovirus with high production efficiency to recapitulate the crucial interaction between RBD-ACE2 by expressing S protein variants corresponding to the original and the predominant G614D SARS-CoV-2 strains and by quantitatively measuring infectivity with a luciferase assay under BSL 2.

Introduction

Traditionally, measuring the infectivity of SARS-CoV-2 requires a live virus which creates serious biosafety concerns (BSL-3). Infectivity of different strains can be measured by the binding affinity between the receptor-binding domain (RBD) of Spike protein (S protein) and its human ACE2 receptor, which is how the virus gains entry into human cells. As the most critical step during infection, SARS-CoV-2 uses its Spike protein receptor-binding domain (S-RBD) to engage with the host cell receptor angiotensin-converting enzyme 2 (ACE2). Various genetic mutations in the S protein affect the RBD-ACE2 interaction, contributing to different infectivities.

Atomic structural modeling

We performed a structural modeling analysis of an interaction between S protein of SARS-CoV-2 and ACE2 using wild type 614D and 614G variant.

Method

1) We first obtained crystal structural data on an S protein trimer without bound to RBD (6XS6). We compared to the distance information between D614 and neighboring T859 and between G614 and neighboring T859 (reference: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7492024/).

2). We next build structural models of S G614 trimer binding to one ACE2 from structures of wildtype D614 (PDB: 7A94, 7A95,7A96,7A97,7A98) by replacing D at position 614 with G wotb visualization using a publicly available software Pymol (https://pymol.org/2/).

Result

The D to G change at the position 614 didn’t interfere with RBD-ACE2 interaction directly as position 614 is located far outside of the RBD region in a 3D structure (left and right panel). We then did further structural modeling which revealed D614 and neighboring T859 forms a hydrogen bond. Compared to an original D614 structure, structure models containing G614 no longer formed a hydrogen bond with T859. When ACE2 was bound to an S trimer. The distance between G614 and adjacent T859 were almost the same (around 6.7 Å) and there is no correlation with any RBD conformation changes regarding D614 or G614 variant (models from PDB: 7A94, 7A95,7A96). Above results suggest G614 variant does not seem to affect directly an RBD-ACE2 interaction, It may contribute to increased infectivity by affecting the overall structural of S protein therefore more accessible by ACE2.

model conformation compared to 6XS6* Distance between G614-T859
7A94 1 ACE2 bound G614 has a 1.2~1.5Å distance shift in main chain.
All three models have similar results in this region. 		6.9
7A95 1 ACE2 bound and 1 RBD erect in clockwise direction 6.6
7A96 1 ACE2 bound and 1 RBD erect in anticlockwise direction 6.8
Path Model

we developed a pseudovirus assay system expressing wild type S and D614G variant and a luciferase reporter. SARS-CoV-2 S or variant pseudovirus were produced based on lentivirus system.

Design Framework

In the whole model, we proposed our research procedures including materials of plasmids, methods to culture cells, produce and titration, and analysis of results to evaluate infectivity and neutralization of pseudovirus. Finally, we concluded that this pseudovirus assay system could express wild type S and D614G variant and a luciferase reporter with high transfection efficacy and low level of BSL 2.

Transfection of pseudovirus

We cloned a full-length S gene (S-FL, 1273 amino acid) into a pCAGGS vector and generate a wild type S pseudovirus (pCAGGS-S) and found that the efficacy of virus packaging and production was very low. Then, we engineered a deletion mutant S1254 with a c-terminal 19 amino acid deletion (…KFDEDDSEPVLKGVALAYT, from 1255-1273) and found S1254 had a much higher packaging efficacy titer, around 10 fold than S-FL.

We transfected the 293T cell when it reaches ~80% confluency.

  1. prepare two 15ml tube, add 1ml OPTI-MEM to each tube.
  2. one tube add 40 ul lipofectamine 3000, the other tube add 40 ul P3000 reagent and the following plasmids:
    12ug pLOVE-Luciferase-EGFP + 6ug psPAX2 + 2ug S or S (1-1254aa), let stand for 5min
  3. transfer the mix in the first tube to the second tube, gently blow a few times, let stand for 15~20min
  4. remove Medium for 293T and add 3ml fresh Medium, then add the 2ml mixture dropwise to the medium
  5. replace with 10ml fresh Medium about 8h after transfection (about 6:00 PM)
  6. By Viral RNA extraction Kit (TAKARA), we extracted the RNA of S and S (1-1254aa) pseudovirus, the concentration of S and S (1-1254aa) viral RNA is 80ng/ul and 100ng/ul, respectively.
  7. By iScript cDNA Synthesis Kit (Bio-rad, 1708890), S and S (1-1254aa) cDNA were synthesis.
  8. By lentivirus qPCR Titration Kit (Transgen, FV201), we measured the titer of S and S (1-1254aa).

S-FLS (1-1254aa)
Titer33325.4205270384.017

Generation of pseudovirus

We packaged pseudovirus by transfection 293T cells using either pCAGGS S, psPAX2, and pLOVE-Luc.-GFP for the S, or pCAGGS S-D614G , psPAX2, and pLOVE-Luc.-GFP for the S-D614G variant. S-D614G is a pseudovirus with genetic mutation.

Due to the higher package efficiency of S (1-1254aa), we aim to use the S (1-1254aa) in subsequent experiments. As many paper described, D614G has much higher infection efficiency, so we choose to engineer this site.

  • S mutant—S D614G
    1. PCR
      1. a) 1ul primer F (10uM) + 1ul primer R (10uM) + 25ul 2X PCR reaction mix (Vazyme) + 0.2ul pCAGGS-S plasmid (1ug/ul) + 22.8uL nuclease free water
    2. Gel electrophoresis
      1. a) 1% agarose gel 120V 30min
    3. Gel extraction
      1. a) By QIAquick Gel Extraction Kit (Qiagen, 28704), we purified the S and S-D614G DNA, the product were stored at -20℃.
    4. DMT
      1. 15ul gel extraction product + 1ul DMT enzyme + 2ul 5Xbuffer + 2 ul ddH2O = total 20 ul
  • S and S-D614G construct (circled)
    1. a) Exanse II
      0.5ul recombination Exanse II enzyme + 1ul 5X buffer + 3.5ul DMT-digested product=total 5 ul
    2. b) Transform
      We then transform the 5ul recombined product into Stbl3 (TransGen).
  • clone selection
    1. a) we select two from each plate using sterile tips to 10ml tube, each tube contains 6ml LB medium and 6ul 100mg/ml Amp
    2. b) cap the tube and secure at 45 angles in the incubator and shake at 37C, 225 rpm for 1hg. plate 50-100uL step 9 product on pre-warmed LB-ampicillin plate by using a sterile wiper, incubate at 37℃ O/N
  • 5. Extract the plamids DNA of single clones according to Mini Prep protocol, then we send the plamids to company for sequencing.
  • 6. Analysis the sequencing result, we got one D614G mutant clone, the site 614 of WT S is GAC(coding D, short for Asp amino acid), this site of mutant S-D614G is GGC (coding G, short for Gly amino acid).
  • S-D614-F 5’…CTGTACCAGGACGTGAATTGCACCGAGGTGC…3’
    S-D614G-F 5’…TGCAATTCACGGCCTGGTACAGCACGGCCACC…3’
  • Transfection
    we are ready to transfect the 293T cell when it reaches ~80% confluency.
    1. prepare two 15ml tube, add 1ml OPTI-MEM to each tube.
    2. one tube add 40 ul lipofectamine 3000, the other tube add 40 ul P3000 reagent and the following plasmids: 12ug pLOVE-Luciferase-EGFP + 6ug psPAX2 + 2ug S or S (1-1254aa) D614G, let stand for 5min.
    3. transfer the mix in the first tube to the second tube, gently blow a few times, let stand for 15~20min
    4. remove Medium for 293T and add 3ml fresh Medium, then add the 2ml mixture dropwise to the medium
    5. replace with 10ml fresh Medium about 8h after transfection (about 6:00 PM)

Infectivity and Neutralization assays

A luciferase assay result showed that antibodies in serum from a monkey vaccinated with an RBD protein exhibit good neutralizing activities, with a slightly better activity against S-D614G (IC50 log -4.5 than S (IC50 log -4).

  • Pseudovirus infection assay (luciferase assay)
    Luciferase activity was measured 48 h after infection according to ONE-GloTM Luciferase Assay System Technical Manual (E6120, Promega).
    Reaction equation of Luciferase:
    1. ONE-GloTM reagents were thawed at room temperature and mix well after thawing
    2. the 96-well containing ACE2-293T cells were took out from the incubator and equilibrated to room temperature before adding the reagent
    3. add a volumn of reagent equal to that of the culture medium in each well. Mix for optimal consistency. As we use 96-well plates, 100ul of reagent is added to the cells grown in 100ul of medium.
    4. wait for ~3 min to allow complete cell lysis and measure in a luminometer.
    SS-D614G
    4.00E+04684412610
    8.00E+042292728368
    1.60E+05132604164428
    3.20E+05495633597398
    6.40E+05616276938601

    Next, we want to test whether this plateform can apply to evaluation of neutralizing antibody. We got serum sample, which is harvested at Day 35 post vaccination by an RBD vaccine, a kindly gift from Dr. Jingyun Yang (West China Hospital, Sichuan University), then we use this serum for neutralization assay.

  • Pseudovirus neutralization assay
    1. Firstly, we plate two 96-well with ACE2-293T, each well contains 2x104 cells. One plate for S, and another for S-D614G
    2. 12h after cell culture, 50 ul medium containing pseudoviruses (~4x104 vg) were incubated with media or with serially diluted sera from immunized with an RBD vaccine (from 1:1000 to 1:102400) for 1 h at 37℃.
    3. add the mix to the 96-well plates containing ACE2-293T cells.
    4. after 12 h of infection, 100ul fresh culture medium was added to each well.
    dilution% neutralization% neutralization
    SD614G
    0.00292.966297.2637
    0.00190.581595.8541
    0.000575.16589.801
    0.0002564.51882.1725
    0.00012552.401675.2902
    0.000062544.548858.6235
    0.00003125 41.58634.4942
    0.00001562543.368538.0597
    0.000007812533.13135.9867
    0.0000039062538.59931.7579
    0.00000195312532.432431.675

    Neutralization equation:
    % neutralization rate (inhibitory rate) = 1- (measured luciferase units of experiment group/ measured luciferase units of positive control group)x100%

    * Neutralization of infectivity by sera from immunized with an RBD vaccine (Yang et al nature 2020).

References
  1. Wu et al, A new coronavirus associated with human respiratory disease in China, Nature. 2020 Mar;579(7798):265-269. doi: 10.1038/s41586-020-2008-3. 
  2. Hu et al, Development of cell-based pseudovirus entry assay to identify potential viral entry inhibitors and neutralizing antibodies against SARS-CoV-2, Genes Dis. 2020 Jul 17. doi: 10.1016/j.gendis.2020.07.006
  3. Hu et al, D614G mutation of SARS-CoV-2 spike protein enhances viral infectivity, BioRxiv, 2020, doi: https://doi.org/10.1101/2020.06.20.161323. 
  4. Yang et al, A vaccine targeting the RBD of the S protein of SARS-CoV-2 induces protective immunity, Nature. 2020 Jul 29. doi: 10.1038/s41586-020-2599-8.
  5. Zhang et al, The D614G mutation in the SARS-CoV-2 spike protein reduces S1 shedding and increases infectivity, bioRxiv. 2020 Jun 12;2020.06.12.148726. doi: 10.1101/2020.06.12.148726.
  6. Ou et al, Emergence of SARS-CoV-2 spike RBD mutants that enhance viral infectivity through increased human ACE2 receptor binding affinity, BioRxiv, 2020, doi: https://doi.org/10.1101/2020.03.15.991844
  7. Grubaugh et al, Making Sense of Mutation: What D614G Means for the COVID-19 Pandemic Remains Unclear, Cell. 2020 Aug 20;182(4):794-795.doi: 10.1016/j.cell.2020.06.040.
  8. Korber et al, Tracking Changes in SARS-CoV-2 Spike: Evidence that D614G Increases Infectivity of the COVID-19 Virus, Cell. 2020 Aug 20;182(4):812-827.e19.doi: 10.1016/j.cell.2020.06.043.
  9. Wiersinga et al, Pathophysiology, Transmission, Diagnosis, and Treatment of Coronavirus Disease 2019 (COVID-19): A Review, JAMA. 2020 Aug 25;324(8):782-793. doi: 10.1001/jama.2020.12839.
  10. Baum et al, Antibody cocktail to SARS-CoV-2 spike protein prevents rapid mutational escape seen with individual antibodies, Science. 2020 Aug 21;369(6506):1014-1018. doi: 10.1126/science.abd0831.
  11. Hansen et al, Studies in humanized mice and convalescent humans yield a SARS-CoV-2 antibody cocktail, Science. 2020 Aug 21;369(6506):1010-1014. doi: 10.1126/science.abd0827.
  12. Du et al, The spike protein of SARS-CoV--a target for vaccine and therapeutic development, Nat Rev Microbiol. 2009 Mar;7(3):226-36.doi: 10.1038/nrmicro2090
Copyright by the team PYMS GZ China.