Loading menubar.....

Team:PYMS GZ China/Proof Of Concept


Results and Parts
Results
Generation of pseudovirus

First, we cloned the full length S gene S-FL into a pCAGGS vector and generated a wild type S pseudovirus (pCAGGS-S). We evaluated the efficacy of virus packaging and production of the S-FL (full length). After identifying the packing and production effectiveness was low, we induced a mutation (deletion mutant S1254 with a c-terminal 19 amino acid deletion from 1255-1273, Fig. 1a) that created a much higher packaging efficacy as shown in our titration (3.3E+04 in S-FL, 2.7 E+05 in S1254, Fig. 1b). Therefore, we used the S1254 construct representing the wild type S and engineered the S-D614G variant so S1254 was used in all subsequent experiments. Then, based on the pCAGGS-S1254 plasmid, we created the S-D614G variant construct through PCR-based direct mutagenesis. We used a pair of corresponding primers listed in our Materials and Methods. In doing so, we obtained our optimal sized product (Fig. 1c).

Figure 1.

  1. Models of S-FL and S (1-1254aa) depicting target deletion mutation.
  2. Comparison of the pseudovirus production titers of S-FL and S1254 (1-1254).
  3. Amplification of S and S-D614G by PCR-based direct-mutagenesis.

Then, we purified the ideal size of S-D614G PCR product by gel extraction, then we used Expanse II (C214, Vazyme) to digest uncirclized plasmid so the remaining PCR products were circled. Then, the circled S variant S-D614G plasmids were transformed into DH5α competent cells, single clones were selected to grow recombinant plasmids in culture (Fig. 2a) and correct clones were verified by Sanger DNA sequencing (Fig. 2b).

Figure 2.

  1. Bacterial transformation and clone isolation for S (left) and S-D614G (right) variant.
  2. DNA sequencing tracing results showing correct engineering of S and S-D614G variant.

We then packaged pseudovirus by transfecting the 293T cells using either pCAGGS S, psPAX2, and pLOVE-Luc.-GFP for the S, or pCAGGS S-D614G , psPAX2, and pLOVE-Luc.-GFP for the S-D614G variant. Using GFP green fluorescence in the pLOVE-Luc.-GFP vector, we were able to observe a high transfection efficiency of packaged pseudovirus (Figure 3).

Figure 3.

  1. Schematic diagram for pseudovirus packaging using 293T producer cells.
  2. GFP fluorescent microscopic photographs showing 293T cells with successfully packaging and production of S (left) and G614D (right) pseudovirus.
Infectivity and neutralization assays

We applied different amounts of pseudovirus to infect the ACE2-293T cells and quantified corresponding luciferase activities. The result showed that S-D614G was more infective compared to the S pseudovirus by exhibiting more green fluorescence (Fig. 4a) and higher levels of luciferase activities (Fig. 4b).

Next, we performed a neutralization assay in a 96-well cell culture plate, we evaluated the neutralizing activity of a monkey serum sample vaccinated from a RBD protein against S and S-D614G pseudovirus (Fig 5a). A luciferase assay result showed that antibodies in the serum from a monkey vaccinated with an RBD protein exhibit about slightly neutralizing titers against S-D614G than S (Figure 5b).

Figure 4.

  1. GFP fluorescence microscopic photographs showing successful infection of ACE2-293T cells by S (left) and D614G (right) pseudovirus.
  2. Quantification of infectivity levels of S wild type and S-D614G pseudovirus expressed as luciferase activities. Abbreviations: RLU, relative luciferase unit; VG, viral genome.

Figure 5.

  1. Schematic of neutralization assay for evaluating infectivity inhibition by antibodies.
  2. Neutralization of infectivity by sera from immunized with an RBD vaccine (Yang et al nature 2020).
Conclusion and Proof of Concept

Using PCR based mutagenesis, we subsequently genetically engineered a truncated S protein “S1254” which we removed these 19 amino acids. We proved that this synthetic biology approach can improve viral titer production by a factor over 10 fold. Infectivity of different strains can be measured by the binding affinity between the receptor-binding domain (RBD) of Spike protein (S protein) and its human ACE2 receptor, which is how the virus gains entry into human cells. Various genetic mutations in the S protein affect the RBD-ACE2 interaction, therefore contributing to different infectivities. We engineered a pseudovirus to recap this crucial interaction by expressing S proteins corresponding to the original and the predominant D614G SARS-CoV-2 strains and used a luciferase assay to quantitatively measure infectivity. We show an infection graph and higher infectivity by the G614D variant indicating that we were able to create unique pseudoviruses for each strain. This was also confirmed in our Sanger DNA sequencing. Then, we further assessed the ability of neutralization of infection by antibodies from a monkey serum sample vaccinated by an RBD vaccine. We assayed antibodies’ effectiveness to block the interactions between the RBD of S protein and the ACE2 receptors of the original strain as well as the predominant strain D614G. We showed that antibodies effectively block the interactions between the RBD of S protein and the ACE2 receptors of the original S strain as well as the predominant strain D614G (shown in the Fig. 5b), suggesting a vaccine made against the original Wuhan virus can be effective against the mutated, more infectious G614D strain. Our engineered pseudovirus system provides a universal platform for infectivity and immunity evaluation on SARS-CoV-2.

References
  1. SARS-CoV-2 genome sequence.
    Wu et al, A new coronavirus associated with human respiratory disease in China, Nature. 2020 Mar;579(7798):265-269. doi: 10.1038/s41586-020-2008-3.
  2. Pseudovirus
    Hu et al, Development of cell-based pseudovirus entry assay to identify potential viral entry inhibitors and neutralizing antibodies against SARS-CoV-2, Genes Dis. 2020 Jul 17.doi: 10.1016/j.gendis.2020.07.006
    Hu et al, D614G mutation of SARS-CoV-2 spike protein enhances viral infectivity, BioRxiv, 2020, doi: https://doi.org/10.1101/2020.06.20.161323.
  3. Vaccine
    Yang et al, A vaccine targeting the RBD of the S protein of SARS-CoV-2 induces protective immunity, Nature. 2020 Jul 29. doi: 10.1038/s41586-020-2599-8.
  4. More
    Zhang et al, The D614G mutation in the SARS-CoV-2 spike protein reduces S1 shedding and increases infectivity, bioRxiv. 2020 Jun 12;2020.06.12.148726. doi: 10.1101/2020.06.12.148726.
    Ou et al, Emergence of SARS-CoV-2 spike RBD mutants that enhance viral infectivity through increased human ACE2 receptor binding affinity, BioRxiv, 2020, doi: https://doi.org/10.1101/2020.03.15.991844
    Grubaugh et al, Making Sense of Mutation: What D614G Means for the COVID-19 Pandemic Remains Unclear, Cell. 2020 Aug 20;182(4):794-795.doi: 10.1016/j.cell.2020.06.040.
    Korber et al, Tracking Changes in SARS-CoV-2 Spike: Evidence that D614G Increases Infectivity of the COVID-19 Virus, Cell. 2020 Aug 20;182(4):812-827.e19.doi: 10.1016/j.cell.2020.06.043.
    Wiersinga et al, Pathophysiology, Transmission, Diagnosis, and Treatment of Coronavirus Disease 2019 (COVID-19): A Review, JAMA. 2020 Aug 25;324(8):782-793. doi: 10.1001/jama.2020.12839.
    Baum et al, Antibody cocktail to SARS-CoV-2 spike protein prevents rapid mutational escape seen with individual antibodies, Science. 2020 Aug 21;369(6506):1014-1018.doi: 10.1126/science.abd0831.
    Hansen et al, Studies in humanized mice and convalescent humans yield a SARS-CoV-2 antibody cocktail, Science. 2020 Aug 21;369(6506):1010-1014. doi: 10.1126/science.abd0827.
    Du et al, The spike protein of SARS-CoV--a target for vaccine and therapeutic development, Nat Rev Microbiol. 2009 Mar;7(3):226-36.doi: 10.1038/nrmicro2090
Parts
Part Number Part Description Type Designer
BBa_K3683000 A universal platform with pseodoviruse of SARS-CoV-2 Basic: Project Leyi Zheng, Xu Lin Zi Cai, JieYing Gan, Guanghui Sun, Ouqiao Li, Charlotte Zhang, Taylor Khouw Shimizu, Emily Roshan
BBa_K3683001 S(1-1254aa) DNA D614 Basic: DNA Leyi Zheng, Xu Lin Zi Cai, JieYing Gan, Guanghui Sun, Ouqiao Li, Charlotte Zhang, Taylor Khouw Shimizu, Emily Roshan
BBa_K3683002 S(1-1254aa) DNA 614D Basic: DNA Leyi Zheng, Xu Lin Zi Cai, JieYing Gan, Guanghui Sun, Ouqiao Li, Charlotte Zhang, Taylor Khouw Shimizu, Emily Roshan
Supplemental information
Supplementary Table 1

S (1-1254aa) DNA sequence (614D, blue)

ATGTTCGTGTTCCTGGTGCTGCTGCCCCTGGTGAGCAGCCAGTGCGTGAATCTGACCACAAGAACCCAGCTGCCTCCCGCCTACACAAACAGCTTCACAAGAGGCGTGTACTACCCCGACAAGGTGTTCAGGAGCAGCGTGCTGCACTCCACCCAGGATCTGTTCCTGCCCTTTTTCTCCAATGTGACCTGGTTCCACGCCATCCACGTGTCCGGCACAAACGGCACAAAGAGGTTTGACAATCCCGTGCTGCCTTTCAATGACGGCGTGTACTTCGCCAGCACCGAGAAGTCCAATATCATCAGGGGCTGGATCTTCGGCACCACCCTGGATAGCAAGACCCAGTCCCTGCTGATCGTGAATAACGCCACCAATGTGGTCATTAAGGTGTGTGAGTTCCAGTTTTGTAATGACCCTTTTCTGGGCGTGTACTATCACAAGAACAATAAGAGCTGGATGGAGTCCGAGTTTAGGGTGTACAGCAGCGCCAACAACTGTACCTTTGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAGGGCAAGCAGGGCAACTTTAAGAACCTGAGGGAGTTTGTGTTTAAGAATATCGACGGCTACTTCAAGATCTACTCCAAGCACACACCCATCAACCTGGTGAGAGACCTGCCCCAGGGCTTTAGCGCCCTGGAGCCCCTGGTGGACCTGCCAATCGGCATCAACATCACCAGATTTCAGACACTGCTGGCCCTGCACAGGTCCTACCTGACACCTGGCGATTCCAGCTCCGGCTGGACCGCCGGAGCCGCTGCTTACTACGTGGGCTACCTGCAACCCAGAACATTCCTGCTGAAGTACAACGAGAATGGCACCATCACCGATGCCGTGGACTGTGCCCTGGACCCTCTGTCCGAGACCAAGTGTACACTGAAGAGCTTTACCGTGGAGAAGGGCATCTACCAGACCAGCAACTTCAGGGTGCAGCCTACAGAGTCCATCGTGAGGTTTCCTAATATCACCAATCTGTGCCCTTTCGGCGAGGTGTTTAACGCCACAAGGTTTGCCTCCGTGTACGCCTGGAATAGGAAGAGAATCAGCAATTGTGTGGCCGACTACAGCGTGCTGTACAACAGCGCCAGCTTCAGCACATTCAAGTGTTACGGCGTGTCCCCCACCAAGCTGAACGACCTGTGCTTCACCAACGTGTACGCCGACTCCTTCGTGATCAGAGGCGATGAGGTGAGGCAGATCGCCCCCGGCCAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGATTTTACAGGCTGCGTGATCGCCTGGAACAGCAACAACCTGGATAGCAAAGTGGGCGGCAACTACAACTACCTGTACAGGCTGTTCAGAAAGAGCAATCTGAAGCCCTTCGAGAGAGATATCAGCACCGAGATCTACCAGGCCGGCAGCACACCCTGTAACGGCGTGGAGGGCTTTAATTGTTACTTCCCCCTGCAATCCTACGGCTTCCAGCCCACCAATGGCGTGGGCTACCAGCCTTACAGAGTGGTGGTGCTGTCCTTCGAGCTGCTGCACGCCCCCGCCACCGTGTGTGGACCTAAGAAGAGCACCAACCTGGTGAAGAACAAGTGCGTGAACTTTAATTTCAATGGCCTGACCGGCACCGGCGTGCTGACAGAGTCCAACAAGAAGTTTCTGCCTTTCCAGCAGTTTGGCAGAGATATCGCCGATACAACAGACGCCGTGAGAGATCCTCAGACACTGGAGATCCTGGATATCACACCCTGCTCCTTCGGCGGCGTGTCCGTGATCACACCTGGCACAAATACAAGCAATCAGGTGGCCGTGCTGTACCAGGACGTGAATTGCACCGAGGTGCCTGTGGCCATCCACGCCGATCAGCTGACACCCACATGGAGAGTGTACAGCACCGGCAGCAACGTGTTCCAGACCAGAGCCGGCTGTCTGATCGGCGCCGAGCACGTGAATAACTCCTACGAGTGTGACATCCCCATCGGCGCCGGCATCTGCGCCAGCTACCAGACACAGACAAACTCCCCCAGGAGGGCCAGATCCGTGGCCTCCCAGTCCATCATCGCCTACACAATGTCCCTGGGCGCCGAGAACTCCGTGGCCTACTCCAACAACTCCATCGCCATCCCTACAAACTTCACAATCAGCGTGACAACAGAGATCCTGCCCGTGTCCATGACCAAGACCAGCGTGGACTGTACCATGTACATCTGCGGCGATAGCACCGAGTGCTCCAATCTGCTGCTGCAATACGGCTCCTTCTGTACCCAGCTGAATAGGGCCCTGACAGGCATCGCCGTGGAGCAGGACAAGAACACCCAGGAGGTGTTCGCCCAGGTGAAGCAGATCTACAAGACACCCCCTATCAAGGACTTCGGCGGCTTTAACTTTAGCCAGATCCTGCCTGACCCTTCCAAGCCCTCCAAGAGATCCTTCATCGAGGATCTGCTGTTTAATAAGGTGACCCTGGCCGATGCCGGCTTCATCAAGCAGTACGGCGACTGCCTGGGCGATATCGCCGCCAGAGACCTGATCTGCGCCCAGAAGTTTAACGGCCTGACCGTGCTGCCTCCCCTGCTGACCGATGAGATGATCGCCCAGTACACATCCGCCCTGCTGGCCGGCACAATCACATCCGGCTGGACATTCGGCGCCGGCGCCGCTCTGCAAATCCCCTTCGCCATGCAGATGGCCTACAGGTTTAACGGCATCGGCGTGACACAGAACGTGCTGTACGAGAATCAGAAGCTGATCGCCAACCAGTTCAATTCCGCCATCGGCAAGATCCAGGACTCCCTGTCCAGCACCGCCTCCGCCCTGGGAAAGCTGCAAGACGTCGTGAATCAGAACGCACAGGCCCTGAATACTCTGGTGAAGCAGCTGTCCTCTAACTTCGGCGCCATTAGTTCAGTGCTGAATGATATCCTGAGCCGGCTGGACAAAGTCGAGGCTGAAGTGCAGATTGACCGCCTGATCACAGGGCGACTGCAGAGCCTGCAGACTTATGTGACCCAGCAGCTGATTCGGGCTGCAGAAATCAGAGCTAGCGCAAATCTGGCCGCTACCAAGATGTCTGAGTGCGTCCTGGGCCAGAGTAAGAGAGTGGACTTTTGTGGGAAAGGATATCACCTGATGTCATTCCCACAGAGCGCCCCTCACGGAGTCGTGTTTCTGCATGTCACCTACGTGCCAGCTCAGGAGAAGAACTTCACTACCGCCCCCGCTATCTGCCACGATGGCAAAGCCCATTTTCCTAGGGAAGGCGTCTTCGTGTCCAACGGGACTCATTGGTTTGTGACCCAGCGCAATTTCTACGAGCCACAGATCATTACAACTGACAATACCTTCGTGTCTGGAAACTGTGATGTCGTGATTGGCATCGTCAACAATACAGTGTATGATCCTCTGCAGCCAGAGCTGGACTCCTTTAAGGAGGAACTGGATAAGTACTTCAAAAATCACACCTCTCCCGACGTGGATCTGGGGGACATTTCTGGAATCAATGCAAGTGTCGTGAACATTCAGAAGGAGATCGACAGGCTGAACGAAGTGGCCAAAAATCTGAACGAGTCCCTGATCGATCTGCAGGAGCTGGGCAAGTATGAACAGTACATCAAGTGGCCCTGGTACATTTGGCTGGGCTTCATCGCAGGGCTGATTGCCATCGTCATGGTGACCATCATGCTGTGCTGTATGACATCTTGCTGTAGTTGCCTGAAGGGGTGCTGTTCATGTGGAAGCTGCTGT

S-D614G (1-1254aa) DNA sequence (Red, 614G)

ATGTTCGTGTTCCTGGTGCTGCTGCCCCTGGTGAGCAGCCAGTGCGTGAATCTGACCACAAGAACCCAGCTGCCTCCCGCCTACACAAACAGCTTCACAAGAGGCGTGTACTACCCCGACAAGGTGTTCAGGAGCAGCGTGCTGCACTCCACCCAGGATCTGTTCCTGCCCTTTTTCTCCAATGTGACCTGGTTCCACGCCATCCACGTGTCCGGCACAAACGGCACAAAGAGGTTTGACAATCCCGTGCTGCCTTTCAATGACGGCGTGTACTTCGCCAGCACCGAGAAGTCCAATATCATCAGGGGCTGGATCTTCGGCACCACCCTGGATAGCAAGACCCAGTCCCTGCTGATCGTGAATAACGCCACCAATGTGGTCATTAAGGTGTGTGAGTTCCAGTTTTGTAATGACCCTTTTCTGGGCGTGTACTATCACAAGAACAATAAGAGCTGGATGGAGTCCGAGTTTAGGGTGTACAGCAGCGCCAACAACTGTACCTTTGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAGGGCAAGCAGGGCAACTTTAAGAACCTGAGGGAGTTTGTGTTTAAGAATATCGACGGCTACTTCAAGATCTACTCCAAGCACACACCCATCAACCTGGTGAGAGACCTGCCCCAGGGCTTTAGCGCCCTGGAGCCCCTGGTGGACCTGCCAATCGGCATCAACATCACCAGATTTCAGACACTGCTGGCCCTGCACAGGTCCTACCTGACACCTGGCGATTCCAGCTCCGGCTGGACCGCCGGAGCCGCTGCTTACTACGTGGGCTACCTGCAACCCAGAACATTCCTGCTGAAGTACAACGAGAATGGCACCATCACCGATGCCGTGGACTGTGCCCTGGACCCTCTGTCCGAGACCAAGTGTACACTGAAGAGCTTTACCGTGGAGAAGGGCATCTACCAGACCAGCAACTTCAGGGTGCAGCCTACAGAGTCCATCGTGAGGTTTCCTAATATCACCAATCTGTGCCCTTTCGGCGAGGTGTTTAACGCCACAAGGTTTGCCTCCGTGTACGCCTGGAATAGGAAGAGAATCAGCAATTGTGTGGCCGACTACAGCGTGCTGTACAACAGCGCCAGCTTCAGCACATTCAAGTGTTACGGCGTGTCCCCCACCAAGCTGAACGACCTGTGCTTCACCAACGTGTACGCCGACTCCTTCGTGATCAGAGGCGATGAGGTGAGGCAGATCGCCCCCGGCCAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGATTTTACAGGCTGCGTGATCGCCTGGAACAGCAACAACCTGGATAGCAAAGTGGGCGGCAACTACAACTACCTGTACAGGCTGTTCAGAAAGAGCAATCTGAAGCCCTTCGAGAGAGATATCAGCACCGAGATCTACCAGGCCGGCAGCACACCCTGTAACGGCGTGGAGGGCTTTAATTGTTACTTCCCCCTGCAATCCTACGGCTTCCAGCCCACCAATGGCGTGGGCTACCAGCCTTACAGAGTGGTGGTGCTGTCCTTCGAGCTGCTGCACGCCCCCGCCACCGTGTGTGGACCTAAGAAGAGCACCAACCTGGTGAAGAACAAGTGCGTGAACTTTAATTTCAATGGCCTGACCGGCACCGGCGTGCTGACAGAGTCCAACAAGAAGTTTCTGCCTTTCCAGCAGTTTGGCAGAGATATCGCCGATACAACAGACGCCGTGAGAGATCCTCAGACACTGGAGATCCTGGATATCACACCCTGCTCCTTCGGCGGCGTGTCCGTGATCACACCTGGCACAAATACAAGCAATCAGGTGGCCGTGCTGTACCAGGACGTGAATTGCACCGAGGTGCCTGTGGCCATCCACGCCGATCAGCTGACACCCACATGGAGAGTGTACAGCACCGGCAGCAACGTGTTCCAGACCAGAGCCGGCTGTCTGATCGGCGCCGAGCACGTGAATAACTCCTACGAGTGTGACATCCCCATCGGCGCCGGCATCTGCGCCAGCTACCAGACACAGACAAACTCCCCCAGGAGGGCCAGATCCGTGGCCTCCCAGTCCATCATCGCCTACACAATGTCCCTGGGCGCCGAGAACTCCGTGGCCTACTCCAACAACTCCATCGCCATCCCTACAAACTTCACAATCAGCGTGACAACAGAGATCCTGCCCGTGTCCATGACCAAGACCAGCGTGGACTGTACCATGTACATCTGCGGCGATAGCACCGAGTGCTCCAATCTGCTGCTGCAATACGGCTCCTTCTGTACCCAGCTGAATAGGGCCCTGACAGGCATCGCCGTGGAGCAGGACAAGAACACCCAGGAGGTGTTCGCCCAGGTGAAGCAGATCTACAAGACACCCCCTATCAAGGACTTCGGCGGCTTTAACTTTAGCCAGATCCTGCCTGACCCTTCCAAGCCCTCCAAGAGATCCTTCATCGAGGATCTGCTGTTTAATAAGGTGACCCTGGCCGATGCCGGCTTCATCAAGCAGTACGGCGACTGCCTGGGCGATATCGCCGCCAGAGACCTGATCTGCGCCCAGAAGTTTAACGGCCTGACCGTGCTGCCTCCCCTGCTGACCGATGAGATGATCGCCCAGTACACATCCGCCCTGCTGGCCGGCACAATCACATCCGGCTGGACATTCGGCGCCGGCGCCGCTCTGCAAATCCCCTTCGCCATGCAGATGGCCTACAGGTTTAACGGCATCGGCGTGACACAGAACGTGCTGTACGAGAATCAGAAGCTGATCGCCAACCAGTTCAATTCCGCCATCGGCAAGATCCAGGACTCCCTGTCCAGCACCGCCTCCGCCCTGGGAAAGCTGCAAGACGTCGTGAATCAGAACGCACAGGCCCTGAATACTCTGGTGAAGCAGCTGTCCTCTAACTTCGGCGCCATTAGTTCAGTGCTGAATGATATCCTGAGCCGGCTGGACAAAGTCGAGGCTGAAGTGCAGATTGACCGCCTGATCACAGGGCGACTGCAGAGCCTGCAGACTTATGTGACCCAGCAGCTGATTCGGGCTGCAGAAATCAGAGCTAGCGCAAATCTGGCCGCTACCAAGATGTCTGAGTGCGTCCTGGGCCAGAGTAAGAGAGTGGACTTTTGTGGGAAAGGATATCACCTGATGTCATTCCCACAGAGCGCCCCTCACGGAGTCGTGTTTCTGCATGTCACCTACGTGCCAGCTCAGGAGAAGAACTTCACTACCGCCCCCGCTATCTGCCACGATGGCAAAGCCCATTTTCCTAGGGAAGGCGTCTTCGTGTCCAACGGGACTCATTGGTTTGTGACCCAGCGCAATTTCTACGAGCCACAGATCATTACAACTGACAATACCTTCGTGTCTGGAAACTGTGATGTCGTGATTGGCATCGTCAACAATACAGTGTATGATCCTCTGCAGCCAGAGCTGGACTCCTTTAAGGAGGAACTGGATAAGTACTTCAAAAATCACACCTCTCCCGACGTGGATCTGGGGGACATTTCTGGAATCAATGCAAGTGTCGTGAACATTCAGAAGGAGATCGACAGGCTGAACGAAGTGGCCAAAAATCTGAACGAGTCCCTGATCGATCTGCAGGAGCTGGGCAAGTATGAACAGTACATCAAGTGGCCCTGGTACATTTGGCTGGGCTTCATCGCAGGGCTGATTGCCATCGTCATGGTGACCATCATGCTGTGCTGTATGACATCTTGCTGTAGTTGCCTGAAGGGGTGCTGTTCATGTGGAAGCTGCTGT

Supplementary Table 2

S (1-1254aa) protein sequence

MFVFLVLLPLVSSQCVNLTTRTQLPPAYTNSFTRGVYYPDKVFRSSVLHSTQDLFLPFFSNVTWFHAIHVSGTNGTKRFDNPVLPFNDGVYFASTEKSNIIRGWIFGTTLDSKTQSLLIVNNATNVVIKVCEFQFCNDPFLGVYYHKNNKSWMESEFRVYSSANNCTFEYVSQPFLMDLEGKQGNFKNLREFVFKNIDGYFKIYSKHTPINLVRDLPQGFSALEPLVDLPIGINITRFQTLLALHRSYLTPGDSSSGWTAGAAAYYVGYLQPRTFLLKYNENGTITDAVDCALDPLSETKCTLKSFTVEKGIYQTSNFRVQPTESIVRFPNITNLCPFGEVFNATRFASVYAWNRKRISNCVADYSVLYNSASFSTFKCYGVSPTKLNDLCFTNVYADSFVIRGDEVRQIAPGQTGKIADYNYKLPDDFTGCVIAWNSNNLDSKVGGNYNYLYRLFRKSNLKPFERDISTEIYQAGSTPCNGVEGFNCYFPLQSYGFQPTNGVGYQPYRVVVLSFELLHAPATVCGPKKSTNLVKNKCVNFNFNGLTGTGVLTESNKKFLPFQQFGRDIADTTDAVRDPQTLEILDITPCSFGGVSVITPGTNTSNQVAVLYQDVNCTEVPVAIHADQLTPTWRVYSTGSNVFQTRAGCLIGAEHVNNSYECDIPIGAGICASYQTQTNSPRRARSVASQSIIAYTMSLGAENSVAYSNNSIAIPTNFTISVTTEILPVSMTKTSVDCTMYICGDSTECSNLLLQYGSFCTQLNRALTGIAVEQDKNTQEVFAQVKQIYKTPPIKDFGGFNFSQILPDPSKPSKRSFIEDLLFNKVTLADAGFIKQYGDCLGDIAARDLICAQKFNGLTVLPPLLTDEMIAQYTSALLAGTITSGWTFGAGAALQIPFAMQMAYRFNGIGVTQNVLYENQKLIANQFNSAIGKIQDSLSSTASALGKLQDVVNQNAQALNTLVKQLSSNFGAISSVLNDILSRLDKVEAEVQIDRLITGRLQSLQTYVTQQLIRAAEIRASANLAATKMSECVLGQSKRVDFCGKGYHLMSFPQSAPHGVVFLHVTYVPAQEKNFTTAPAICHDGKAHFPREGVFVSNGTHWFVTQRNFYEPQIITTDNTFVSGNCDVVIGIVNNTVYDPLQPELDSFKEELDKYFKNHTSPDVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQYIKWPWYIWLGFIAGLIAIVMVTIMLCCMTSCCSCLKGCCSCGSCC

S-D614G (1-1254aa) protein sequence

MFVFLVLLPLVSSQCVNLTTRTQLPPAYTNSFTRGVYYPDKVFRSSVLHSTQDLFLPFFSNVTWFHAIHVSGTNGTKRFDNPVLPFNDGVYFASTEKSNIIRGWIFGTTLDSKTQSLLIVNNATNVVIKVCEFQFCNDPFLGVYYHKNNKSWMESEFRVYSSANNCTFEYVSQPFLMDLEGKQGNFKNLREFVFKNIDGYFKIYSKHTPINLVRDLPQGFSALEPLVDLPIGINITRFQTLLALHRSYLTPGDSSSGWTAGAAAYYVGYLQPRTFLLKYNENGTITDAVDCALDPLSETKCTLKSFTVEKGIYQTSNFRVQPTESIVRFPNITNLCPFGEVFNATRFASVYAWNRKRISNCVADYSVLYNSASFSTFKCYGVSPTKLNDLCFTNVYADSFVIRGDEVRQIAPGQTGKIADYNYKLPDDFTGCVIAWNSNNLDSKVGGNYNYLYRLFRKSNLKPFERDISTEIYQAGSTPCNGVEGFNCYFPLQSYGFQPTNGVGYQPYRVVVLSFELLHAPATVCGPKKSTNLVKNKCVNFNFNGLTGTGVLTESNKKFLPFQQFGRDIADTTDAVRDPQTLEILDITPCSFGGVSVITPGTNTSNQVAVLYQGVNCTEVPVAIHADQLTPTWRVYSTGSNVFQTRAGCLIGAEHVNNSYECDIPIGAGICASYQTQTNSPRRARSVASQSIIAYTMSLGAENSVAYSNNSIAIPTNFTISVTTEILPVSMTKTSVDCTMYICGDSTECSNLLLQYGSFCTQLNRALTGIAVEQDKNTQEVFAQVKQIYKTPPIKDFGGFNFSQILPDPSKPSKRSFIEDLLFNKVTLADAGFIKQYGDCLGDIAARDLICAQKFNGLTVLPPLLTDEMIAQYTSALLAGTITSGWTFGAGAALQIPFAMQMAYRFNGIGVTQNVLYENQKLIANQFNSAIGKIQDSLSSTASALGKLQDVVNQNAQALNTLVKQLSSNFGAISSVLNDILSRLDKVEAEVQIDRLITGRLQSLQTYVTQQLIRAAEIRASANLAATKMSECVLGQSKRVDFCGKGYHLMSFPQSAPHGVVFLHVTYVPAQEKNFTTAPAICHDGKAHFPREGVFVSNGTHWFVTQRNFYEPQIITTDNTFVSGNCDVVIGIVNNTVYDPLQPELDSFKEELDKYFKNHTSPDVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQYIKWPWYIWLGFIAGLIAIVMVTIMLCCMTSCCSCLKGCCSCGSCC

Supplementary maps

1. pLOVE-Luciferase-GFP

2. psPAX2

3. pCAGGS-S

4. pCAGGS-S D614G