Home|| Worldshaper-Shanghai 2020 || Worldshaper-Shanghai HTML Template
Contribution
Model
We provide two parts of information on this page. The first part, we will introduce a general guide of the detecting technique we created this season to people in need. The second part summarizes some useful information about toehold switch for the iGEM teams that will use toehold switch in the future.
Part1
Toehold switch technical guide for detecting target cDNA or DNA
Worldshaper-Shanghai 2020 has made a lot of efforts in the exploration for early stage prostate cancer diagnosis during this season. Although our work has encountered many difficulties due to the impact of COVID-19, we have verified our diagnostic techniques in lab successfully.
Our project design could be applied to other fields, since we used the universal trigger and hairpin structure sequence to combine gene amplification with toehold switch. In other words, our design can be applied to any target gene detection (cDNA or DNA). Users only need to combine their target gene specific primers with the adapters provided by us, and they can use our method successfully. The detailed applied method is as follows:
5’-TGAATGAATTGTAGGCTTGTTATAGTTATGCAGAAACAGAGGAGACATAACA TGAACAAGCCTAACCTGGCGGCAGCGCAAAAG-3’ (Toehold switch combined with the underline-labeled T7 sequence)
Figure 1 The technical process of cDNA/DNA visual detection with the help of toehold switch
Step1: Gene amplification
1.Primer design
In addition to following the widely used principles of primer design, it is necessary to avoid the formation of secondary structures between primer sequences and adapters. Note: Before the next step, PCR can be used to verify the amplification efficiency of the primers.
2.Add adapter to your primers
Forward primer: 5’-TAATACGACTCACTATAGGG+gene specific forward primer-3’ Reverse primer: 5’-GTTTGAATGAATTGTAGGCTTGTTATAGTTATGTT+gene specific reverse primer-3’ Note: You can also verify the amplification efficiency of these longer primers by PCR.
3.Start amplification
If you want your project to be used in more everyday occasions, you need to find a way to replace PCR reaction, which requires specialized equipment like thermocycler. Recombinase Polymerase Amplification method (RPA) could be a good choice that can complete amplification in a shorter time than PCR and only needs 37 ℃ of heating[1]. You can construct your own RPA reaction by using commercially available kits.
Notes:
·To amplify the DNA products of 100bp~200 bp are more efficient and time-saving, so you can modify the position of gene specific primers on cDNA or genome to control the length of the amplified gene fragment.
·Different primers need to determine different temperature and incubation time of RPA reaction to avoid the primer-dimer and nonspecific amplification. The temperature and time gradient experiment are recommended to confirm the optimal reaction conditions.
Step2: Visual output
1. Individual toehold switch design
Adding a coding sequence of one kind of reporters (such as chromoprotein) you are interested in at the end of the toehold switch sequence for signal output. Actually, there is a library of reporters in the iGEM Registry that contributed by previous iGEM teams.(Available link: http://parts.igem.org/Protein_coding_sequences/Reporters).
Then constructing the newly designed toehold switch into a simple plasmid backbone (such as pSB1C3) for further use.
Note: Make sure that there are a stop codon and a T7 terminator at the end of your reporter.
2. Coupled Transcription/Translation Procedure
Cell-Free Systems serve as a compatible chassis for in-vitro gene expression. The commercial T7 S30 extract is adopted there. Adding the amplified products obtained in Step1 as well as the newly designed toehold plasmid into the E. coli extract-based cell-free protein synthesis system and starting reaction by following its technical manual, the final visual result can be found after the reaction.
Part2
Brief description of toehold switch
In order to help the future iGEM teams to use toehold switch more conveniently without repeating the same investigation as ours, we have integrated some useful information in this section.
Toehold background
Toehold switch is an RNA-based device, which consists of a cis-repressing switch RNA hairpin and a trans-acting trigger RNA to regular the expression level of the downstream gene[2]. In this hairpin secondary structure, the ribosome-binding site (RBS) is sequestered in the hairpin loop while the start codon is hidden in the hairpin stem, preventing the ribosome from binding to RBS and thereby blocking translation. A single-stranded toehold domain called toehold sequence at the 5′ end of the RNA hairpin provides the initial binding site of the switch, that is designed to be complementary to the trigger RNA (Figure2 a). When trigger RNA combines with toehold sequence via linear-linear interaction, the structure of RNA hairpin is changed, exposing RBS and start codon to induce translation[3-5](Figure2 b).
Toehold switch shows a high level of dynamic range with low system crosstalk, the single-stranded toehold sequence can be cognate RNAs with arbitrary sequences that mean protein production can be linked to almost any RNA input[4]. In other words, this RNA-based device has great potential in many fields like virus detection, disease diagnosis, and gene editing. Studies have shown that it is applied in rapid, low-cost diagnostics of a variety of targets including RNAs from Zika and Ebola viruse[6-9]. Research of integrating toehold switch into sgRNA scaffolds of CRISPR–Cas9 also demonstrated its utility for integrating endogenous cellular information for efficient signal processing[10]. There are also some iGEM projects using toehold switch for cancer diagnosis and pathogen detection, showing more possibilities for this RNA tool.
Figure 2 The design of toehold switches[2] (Auslaender S , Fussenegger M , 2014)
Toehold design
Design of toehold switch involves a series of considerations related to their sequence properties, structures, and specificities[4].
Tips
1.The first stage of the design process includes defining the toehold switch secondary structure, conserved sequences, and interaction domain sizes.
Length of different toehold parts:
·Switch loop size: 15- to 18-nts is better. The loop sequence was designed to have low internal binding, it generally has 50% or more A sequence content and could provide translational enhancement via its high A/U content.
·Toehold length: 12nt (or more) free trigger RNA is better.
·Length of stem unwound: 14nt is better.
2.The NUPACK software package[11] can be used to design toehold switch sequences. The NUPACK functions were run with a specified temperature of 37°C, 1.0 M Na+, and 0 M Mg2+ for free energy parameters, and assumed strand concentrations of 100 nM. The output of these functions provides the free energy of a single RNA strand and bimolecular trigger switch complex, as well as the predicted concentration and minimum free energy secondary structure of three substances in solution[4]. You also can change the input temperature as you like. The term ∆GRBS-Linker indicates the performance of toehold switch, the smaller the ∆GRBS-Linker is, the higher the dynamic range. There is a useful and basic guide that provided by Exeter 2015 iGEM team, more details are on the page https://2015.igem.org/Team:Exeter/Toehold_Design.
3.Here is a brief introduction of the NUPACK design.
Take the toehold structure in the article[4] as an example (see the figure below):
The NUPACK imput is as follows:
trials= 10 (number of generated)
structure switch = ..................((((((((((..((((((...............))))))..))))))))))
(secondary structure of toehold to be generated)
domain a = GGGUCUUAUCUUAUCUAUCUCGUUUAUCCCUGC
(complementary sequence of the specific sequence to be identified)
domain b = N10
(the number of nucleotides is set according to the ring size and stem length)
domain c = AGAGGAGA
(RBS sequence)
domain d = N6
(set the number of nucleotides according to the length of the stem)
domain e = AUG
(start codon)
domain f = N9
(set the number of nucleotides according to the length of the stem)
prevent = aaaa, cccc, gggg, uuuu, kkkkkk, mmmmmm, rrrrrr, ssssss, wwwwww, yyyyyy
switch.seq = a b c d e f
[1] Lobato, Ivan Magriñá, O’ Sullivan, Ciara K. Recombinase polymerase amplification: Basics, applications and recent advances[J]. Trac Trends in Analytical Chemistry, 2018:S0165993617302583.
[2] Soo-Jung, Kim, Matthew, et al. Modulating Responses of Toehold Switches by an Inhibitory Hairpin.[J]. ACS synthetic biology, 2019, Mar 15;8(3):601-605.
[3] Auslaender S , Fussenegger M. Toehold gene switches make big footprints[J]. Nature, 2014, 516(7531):333-334.
[4] Alexander A, Green, Pamela A,et al. Toehold Switches: De-Novo-Designed Regulators of Gene Expression[J]. Cell, 2014,159 (4): 925–39.
[6] Kim J , Zhou Y , Carlson P D , et al. De novo-designed translation-repressing riboregulators for multi-input cellular logic[J]. Nature Chemical Biology, 2019, 15(12):1-10.
[7] Ching-Yuet T A , Ho-Ting C D , Ruoning W A , et al. A comprehensive web tool for toehold switch design[J]. Bioinformatics(16):e1007428.
[8] Keith Pardee, Alexander A. Green, Melissa K. Takahashi, et al. (2016) Rapid Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell 165, 1255–1266.
[9] Coghlan A . 'Bio filter paper' detects diseases[J]. New entist, 2014, 224(2993):14-14.
[10] Siu K H , Chen W . Riboregulated toehold-gated gRNA for programmable CRISPR–Cas9 function[J]. Nature Chemical Biology, 2019, 15(3).
[11] Zadeh J N , Steenberg C D , Bois J S , et al. NUPACK: Analysis and design of nucleic acid systems.[J]. Journal of Computational Chemistry, 2011, 32(1):170-3.
