Team:Worldshaper-Shanghai/Engineering

Home|| Worldshaper-Shanghai 2020 || Worldshaper-Shanghai HTML Template

Engineering Success

Engineering Success


1. The selection of primers：

As mentioned in the project design, we got three pairs of primers for both KLK3 and PCA3.
To improve the efficiency of PCR or RPA, we needed to choose the most appropriate pair of each gene. We did the PCR with the cDNA of prostate cancer cell PC3 and three pairs of primers, respectively. Based on the result of gel electrophoresis, we chose KLK3-2 382bp (KLK3-2F: TGGTGCTGCACCCCTCATC; KLK3-2R: GGGCAGGTCCATGACCTTC) and PCA3-2 196bp (PCA3-2F：GCAAGAGCCACAGAGGGAATG; PCA3-2R: GCGCACTCACCATGAAATGG) as the primer.
results-figure-1
Figure1. Primer test for both KLK3 and PCA3

2. The test of overhang-added primers:

We added a T7 sequence at the 5’ end of forward primer to help start the process of transcription. For the reverse primer, we designed it with a trigger at the 5’ end, so as to add the trigger sequence to the end of PCR product during the process of PCR. The sequences of these overhang-added primers are as follow (The green part is the T7 overhang, while the orange part is the trigger sequence):
T-KLK3-2F：taatacgactcactatagggTGGTGCTGCACCCCTCATC
T-KLK3-2R: gtttgaatgaattgtaggcttgttatagttatgtttGGGCAGGTCCATGACCTTC
T-PCA3-2F: taatacgactcactatagggGCAAGAGCCACAGAGGGAATG
T-PCA3-2R:gtttgaatgaattgtaggcttgttatagttatgtttGCGCACTCACCATGAAATGG
The results of PCR showed that the primers with overhang could also amplify KLK3 and PCA3 successfully without significantly affecting the amplification efficiency.
results-figure-2
Figure2. PCR efficiency test of two kinds of overhang-added primers

3.The preparation for toehold switch:

Since RNA is a kind of unstable nucleic acid that difficult to be preserved, we constructed T7 promoter and toehold switch sequence as well as mCherry into pSB1C3 backbone (we called it “toehold plasmids” later), which could be transcripted to toehold switch RNA by in vitro transcription. The synthesized toehold-switch plasmids were transformed into E.coli for further culture in LB liquid culture with ampicillin, the new single colonies were verified by DNA sequencing:
The sequencing report of these PCR identified colonies showed that the toehold sequence is proper without the base mutation (Figure 3). Finally, we extracted plasmids from these colonies for future use.
results-figure-3
Figure 3. The sequencing report of Toehold swich-mCherry

4. In vitro transcription/translation

The last step involved in the prostate cancer testing procedure is in vitro transcription/translation, which involves transcribing the PCR products and the toehold plasmids into RNA, and then the trigger RNA sequence on PCR product starts the translation of the red fluorescence protein (mCherry) that on the downstream of toehold switch sequence. The whole reaction is based on S30 T7 High-Yield Protein Expression System from Promega, the PCR products of PCA3 (we called it “PCA3 products” later) were selected for validation during this step.
The results were as anticipated: the control group 1 without toehold plasmids showed no sign of red fluorescence; the control group 2 without PCA3 products showed faint fluorescence, and the samples containing PCA3 products and toehold plasmids showed brilliant fluorescence (Figure 4).
results-figure-4
Figure 4. The verification of in vitro transcription/translation involving PCA3 products and toehold plasmids
*Control 1: Toehold plasmids free; Control 2: PCA3 products free;
Sample1/2: Samples containing PCA3 products and toehold plasmids.

5. Product simulation and verification

After choosing the primer and verifying the efficiency of overhang-added primers and in vitro transcription/translation process, we use synthetic urine (CAS Number: R23032-500ml, Shanghai yuan ye Bio-Technology Co., Ltd) to simulate the usage of our product. PCA3 mRNA was added into synthetic urine in advance. A standard curve for the detection of PCA3 in synthetic urine is plotted to determine the effective interval of copies of PCA3 in urine for the detection (Figure5 a), the fluorescence value increased linearly in the range of 200-800 copies, which can be used as an effective range to identify the content of PCA3 mRNA in synthetic urine. For evaluating the reliability of our products, we developed a receiver operating characteristic curve (ROC curve). The amount of PCA3 mRNA is 300 copies of PCA3 mRNA in urine samples. The AUC (area under the curve) value is calculated to be 82.4%, which preliminarily proved the effectiveness of our diagnosis (Figure5 b). More details in Protocol，Proof of Concept，Model page.
results-figure-5
Figure 5. The Standard Curve and ROC Curve for product evaluating

6.Future Work

Using an accurate genetic-based test to select appropriate candidates for prostate biopsies can limit the number of unnecessary biopsies performed and save costs to payers and to the national healthcare system[1]. In order to improve our product design and put forward a better evaluation standard combined with the use of the kit, the following improvements need to be done in this project.

6.1 RPA testing

In order to accommodate the product for a broader range of circumstances, and to minimize the restriction set by equipment and environmental requirements, our project, a urine-based non-invasive diagnosis for early prostate cancer, decide to adopt the RPA method in replacement of PCR reaction, because RPA methods, under identical temperature, enables a shorter time requirement for gene amplification.
We weren’t able to complete this part of the experiment because of the impact of COVID-19, so our first priority in the future will be testing for the ideal reaction time and temperature of both PCA3 and KLK3. It has been discovered that there are certain defects regarding the RPA method, including the primer-dimer and non-specific amplification that are liable to occur in the process[2]. To a certain extent, testing for a more precise reaction time and temperature will prevent the occurrence of non-specific amplification and primer-dimer. Furthermore, since KLK3 already has a relatively higher expression in healthy people than PCA3, we will have to adjust some of the experimental parameters to prevent a false positive test due to the over-amplification of the gene.

6.2 To further improve the applied design

As of now, we have already incorporated the RPA method into the preliminary design, and we will further improve the preliminary design after conducting experiments with the RPA method, making our product more practical and effective. The applied design we proposed this season has been uploaded to the Proposed ImplementationProposed Implementation page.

6.3 Sensitivity and reliability test on the kit

Basing on this year’s work, our current experiment method has successfully achieved the goal of detecting PCA3 molecule in synthetic urine samples. Not only did we successfully run the experiment, we further elaborated on the experiment by producing both a standard curve and a ROC curve that describes both the effective interval for detection and accuracy.
Another test should be run on the above indexes of PCA3 and KLK3 on the synthetic urine after incorporating the RPA method into our experiment.

6.4 Test with actual human urines

Running the experiment with both urine of healthy people and prostate cancer patients, complying with the consent of patients and legal regulation of the country, will help us establish a method of evaluation for prostate cancer diagnosis by cutoff value. A possible way has been found:
There is a probe-based kit available on the market called Progensa PCA3 diagnosis (Gen-Probe, SanDiego, CA, USA). The evaluation method of the kit for prostate cancer, PCA3 ratio, provides a good reference for us. PCA3 ratio, also called the PCA3 score, is much more cancer-specific than serum PSA levels, which are confounded by factors such as prostate volume, age, trauma, and certain drugs. PCA3 score is the ratio of mRNA transcripts of PCA3 to KLK3 in urine (PCA3 score= PCA3mRNA/PSA mRNA×1000), which can be the numerical evidence to determine prostate cancer [3-5].

Reference

[1] Aubry W, Lieberthal R, Willis A, et al. Budget Impact Model: Epigenetic Assay Can Help Avoid Unnecessary Repeated Prostate Biopsies and Reduce Healthcare Spending[J]. American Health and Drug Benefits, 2013, 6(1):15-24.
[2]Lobato, Ivan Magriñá, O’ Sullivan, Ciara K. Recombinase polymerase amplification: Basics, applications, and recent advances[J]. Trac Trends in Analytical Chemistry, 2018:S0165993617302583
[3] Deras IL, Aubin SM, Blase A, et al. PCA3: a molecular urine assay for predicting prostate biopsy outcome. J Urol. 2008;179:1587–1592.
[4]Durand X, Moutereau S, Xylinas E, et al. ProgensaTM PCA3 test for prostate cancer[J]. Expert Review of Molecular Diagnostics, 2011, 11(2):137-144.
[5]Marks L S, Bostwick D G . Prostate Cancer Specificity of PCA3 Gene Testing: Examples from Clinical Practice.[J]. Reviews in urology, 2008, 10(3):175-181.


Worldshaper-Shanghai 2020

New non-invasive technique for early stage prostate cancer diagnosis