Team:GreatBay SCIE/Contribution

• Home
• Team
  • Team
  
  
  • Attributions
  
  
  • Collaborations
• Project
  • Description
  
  
  • Design
  
  
  • Results
  
  
  • Measurement
  
  
  • Parts
  
  
  • Safety
  
  
  • Hardware
  
  
  • Proof of Concept
• Model
  • Overview
  
  
  • Disassociation Constant of Binding
  
  
  • Optimal Test Line Position
• Human Practices
  • Overview
  
  
  • Public Engagement and Education Outreach
  
  
  • Integrated Human Practices
• Notebook
  • Method
  
  
  • Lab Notes
• Awards

Overview

Our contribution to iGEM, Synthetic Biology and STEM can be classified into three parts: improvement on detection of amanitin, on scFv and aptamers and on lateral flow devices.

Detection for Amanitin

We had done a lot to reduce the requirements and the cost of amanitin detection. Firstly, we abandoned the use of traditional antibodies, and successfully tried two kinds of new ligands: scFv and aptamer, which were proved to be better alternatives than antibodies. We had a tremendous success in producing them: We managed to yield an existing sequence of anti-α-amanitin scFv in E.coli BL21(DE3), and improved the production by adding a pelB tag for secretion in periplasm instead of forming inclusion bodies; arginine extraction method and osmotic shock procedure were used to extract scFv from periplasm, which are proved by previous literature as well as our own experience to be effective. We have organized the protocols for those methods for future teams and researchers in our Methods page.We proved scFv's binding affinity through ELISA and ic-ELISA with a very low IC50 calculation result, showing the high sensitivity of binding; We acknowledged that the selection of β-amanitin aptamers was never done by anyone in the academic field, so we have gone through 15 complete cycles of SELEX against β-amanitin, to finally obtain two best aptamers and verified their binding affinities with ELONA.

5'- CATGCTTCCCCAGGGAGATGTAGCGTCTGAAGCCGTTTCATGCATTGCTACAACCCATGAGAGGAACATGCGTCGCAAAC -3'

5'- CATGCTTCCCCAGGGAGATGGCCCGGGGTAACGTAGCCAGATTAGGTCGTGATCGTGATGGAGGAACATGCGTCGCAAAC -3'

Lateral Flow Devices

Lateral flow device is a new technology in the area of detection. We made several modifications to it in order to match our goal, such as the combination of immobilization pad and testline and the incorporation of RPA. We believe that these modifications will inspire others working in aptamers and lateral flow strips, and expand its use to a wider area.

Read More About our Hardware >

A schematic diagram of our hardware.

Experiments on Aptamers

While doing experiments on aptamer, we notice that although many studies on aptamers have been conducted and aptamers have been used in a variety of areas, there is still no general protocols or complete guidelines on aptamer experiments, such as SELEX and ELONA. Since these experiments involve very complex, intricate steps, involving several binding & washing with a handful of reagents. Thus, based on our own experimental experience and existing literature, we have written detailed but condensed protocols for SELEX, ELONA, and Competitive tests for new lab attendants to get familiar with those steps, and for benefiting anyone who wishes to do experiments on these oligonucleotides. Our SELEX protocol deserves a special mention here. It was written by one of our team members, and it successfully guided many of our other members to learn how to do SELEX. With a lot of positive feedback from them, we had decided to share it with the public. Here we post our protocol for ELONA, ELISA, and SELEX.

We also created our own magnetic stand - a vital hardware when doing SELEX - through 3D printing, and it can also help other teams tremendously when doing SELEX with magnetic beads.

A picture of our magnetic stand (compatible with neodymium magnets with dimensions 20mm×10mm×4mm）.

Here is the model of our magnetic stand.

The SELEX Protocol

1. Preparation of aptamer pool

1. Take 50μL of beaming eluate from the previous round (if this is the first round, use the aptamer pool ordered from external companies) to a PCR tube. Name the tube as RN(N refers to the round number)
2. Place RN into the PCR amplifier and start the “quenching” program (100 degrees Celsius, 10 minutes). Immediately take out the PCR tube after the program ends and place it in ice.

2. FISHing

1. Add 184μL of B&W buffer to diluted magnetic beads solution and place it on a magnetic shelf for 30-60s. Then, collect and discard the supernatant. 50μL RN, 950μL Selection Buffer, and 16μL magnetic bead diluent are added to the new EP tube. The EP tube was named Round N (N is the specific number of rounds) and incubated at room temperature for 15-40 min after vortex.
2. After incubation, the Round N is placed on the magnetic shelf for 30-60s, and the supernatant is collected. The supernatant is added to the new EP tube, which is named Pool N X
3. 200-100μL B&W Buffer (the specific volume depends on the number of rounds, see the original Protocol) is added to the Round N. After vortex, the Buffer is placed for 2-10min, and then placed on the magnetic shelf for 30-60s, and the supernatant is collected and discarded. This step is repeated three times.

3. Elusion

1. Open the hot metal bath in advance and set the temperature to 75℃.
2. 60μL ddH2O is added to Round N, then place it in the metal bath for 5min after vortex, and then place it on a magnetic shelf for 30-60s. The supernatant is collected and a new EP tube is used, named Pool N (N is the specific number of rounds)

4. BEAMing

1. BEAMing system (which can be processed at the incubation time) is configured, with 3.8μL taken from Pool N as the template for BEAMing, and the PCR amplifier is equipped with the BEAMing process.
2. Attach the PCR tube of BEAMing product to the side of the magnetic shelf, carefully collect the supernatant, and add it to a new PCR tube, name the PCR tube as BS N (N is the number of specific rounds)
3. Put the Denature product statically on the magnetic shelf for 30-60s, collect the supernatant and add it to a new PCR tube named BE N (N is the specific number of rounds).
4. The control PCR system is configured, the PCR tube is named CP N (N is the specific number of rounds), 1μL is taken from BE N as the template of control PCR, the control PCR program is run in the PCR amplifier, and then verify the product by electrophoresis.
5. Put BE N into the refrigerator at 4℃ for storage and for the next Round of SELEX, and the rest products (such as Pool N, BS N, CP N, Round N X) are also put back into the refrigerator at 4℃ for storage and for control in control PCR.

ELONA protocol

1. Coating of target on 96-well plate

1. Prepare Coating Buffer Solution (pH9.6 NaHCO3-NaCO3) (CBS).
2. Prepare target molecule solutions with mass concentration 40 ng/mL using CBS.
3. Add 100 µL of target molecule solution to the designated wells for experiment.
4. Put inside 4 degrees Celsius refrigerator overnight (>8 hours).
5. Drain the liquid.
6. Add 100 µL PBST to each well used for experiment.
7. Put on vortex mixer for 3 minutes.
8. Drain the liquid in each well.
9. Repeat steps 6-8 for 5 times, for 6 times in total.
10. Add 100µl blocking solution (50 mg/mL solution of skimmed milk powder dissolved in PBST) to each well.
11. Block for 2 hours.
12. Drain the liquid.
13. Repeat steps 6-8 for 6 times.

2. Conjugation

1. Prepare 800nM solution of biotin-modified aptamers using PBS.
2. Add 100 µL of aptamer solution to each well.
3. Incubate at 37 degrees Celsius for 2 hours.
4. Drain the liquid.
5. Repeat steps 6-8 in coating(add PBST, vortex and drain the liquid)for 6 times.
6. Prepare 1/2000 diluted streptavidin-HRP solution.
7. Add 100 µL of streptavidin-HRP solution to each well.
8. Incubate at 37 degrees Celsius for 2 hours.
9. Drain the liquid.
10. Repeat steps 6-8 in coating(add PBST, vortex and drain the liquid)for 6 times.

3. Measurement and Analysis

1. Mix two components of TMB reagent by a volume ratio of 1:1, and vortex to mix thoroughly.
2. Add 100 µL of this mixture to each well.
3. Incubate at 37 degrees Celsius for 15 minutes without light.
4. Add 100µL of 2M H2SO4 solution to each well to stop the reaction.
5. Using a spectrometer, measure the absorbance of light with wavelength 450 nanometers of the liquid in each well.

ELISA protocol

1. Coating of target on 96-well plate

1. Prepare Coating Buffer Solution (pH9.6 NaHCO3-NaCO3) (CBS).
2. Dilute 5 µL 20µg/mL amatoxin solution to 100 µL using CBS
3. Add 100 µL of target molecule solution to the designated wells for experiment.
4. Put inside 4 degrees Celsius refrigerator overnight (>8 hours).
5. Drain the liquid.
6. Add 100 µL PBST to each well used for experiment.
7. Put on vortex mixer for 3 minutes.
8. Drain the liquid in each well.
9. Repeat steps 6-8 for 5 times, for 6 times in total.
10. Add 100µl blocking solution (50 mg/mL solution of skimmed milk powder dissolved in PBST) to each well.
11. Block for 2 hours.
12. Drain the liquid.
13. Repeat steps 6-8 for 6 times.

2. Conjugation

1. Add 50-100 µL antibody solution to each well.
2. Incubate at 37 degrees Celsius for 1 hour, without light.
3. Drain the liquid.
4. Repeat steps 6-8 in coating(add PBST, vortex and drain the liquid)for 6 times.
5. Prepare anti 6*Histag-HRP solution solution: 1:5000 dissolve in PBST. All operation performed on ice.
6. Add 100 µL of anti 6*Histag-HRP solution to each well.
7. Incubate at 37 degrees Celsius for 1 hour, without light.
8. Drain the liquid.
9. Repeat steps 6-8 in coating(add PBST, vortex and drain the liquid)for 6 times.

3. Measurement and Analysis

1. Mix two components of TMB reagent by a volume ratio of 1:1, and vortex to mix thoroughly.
2. Add 100 µL of this mixture to each well.
3. Incubate at 37 degrees Celsius for 30 minutes without light.
4. Add 50µL of 2M H2SO4 solution to each well to stop the reaction.
5. Using a spectrometer, measure the absorbance of light with wavelength 450 nanometers of the liquid in each well.