Engineering principles

Introduction

Synthetic biology is a biology field where engineering principles are applied. Design-Build-Test-Learn is a basic engineering cycle.

This year, we couldn't get into our lab due to COVID-19. So our activities were mostly done by literature research and designing experiments that we are going to do if we can get into our lab. We would like to share some of the struggles we went through for future teams.

We could hardly get into our lab. Engineering principles we followed were based on researching literature, making assumptions and compromises. But it was a great experience since even discussions between us can proceed ahead.

What we did this year to achieve 'Engineering principles'. We archived DBTL cycle we went through in this menu and planned our future experiments in [Link]

DBTL cycle

Brainstorming

Description : We brainstormed for several weeks, creating a mind-map. We converged into 5 key ideas and proceeded to develop them. The ideas were
- Stent made by ELM (Engineered Living Materials)
- 3D bio printer
- DNA Cryptography
- Jaundice Patients' temperature detecting patch

Learn : To select a single topic among the candidates, we set two criteria for selection. 1) Does the topic motivate us? 2) Can we produce a meaningful output with the topic by the end of the project?
- Stent made by ELM (Engineered Living Materials : stents are known to have downsides such as causing blood clots, allergy and hypersensitivity. To deal with this problem, the prerequisites including biocompatibility of a stent was extremely challenging to achieve. When we consulted our PI about this topic, he gave us a feedback that we would only able to partially handle this issue and suggested an experiment that tests whether the biomaterial of our choice can be well expressed in a strain and registering it as a part on the registry of iGEM. We felt that this was not our original intentions about this topic and came to the agreement that this topic doesn’t suits our motivation. But the project is extened to an additional project as a small project - CCP. CCP is a program in Korea University which support research projects. We attended the program with this topic, [Link]
- 3D bio printer : Designing a 3D bio printing system using phototaxic microbes was our original idea. However, we realized that this project heavily relies on it is a mechanical engineering aspect. Our members are mostly based on biotechnology so agreed that it would be hard for us to get a meaningful result.
- DNA Cryptography : Designing a DNA Cryptographic mechanism was also one of our candidates. We considered constructing logic gates with nucleic acids and then using them to emulate cryptographic mechanisms. However, The complex mathmatical concepts that has to be understood was to vast for us to understand within the given amount of time. Thus, we agreed that it would be hard to achieve a meaningful result and that it doesn’t matches our motivation
- Jaundice Patients’ temperature detecting patch : So we chose this topic for our topic of this year

Jaundice Patients

Imagine : We measure the temperature of jaundice patients by a thermopatch. The jaundice patients are treated phototherapy. At that time, their temperature must be monitored. How about using a temperature detecting patch for the situation?

Design : To do the phototherapy, a blue light is used. If the patch detects a certain temperature, it makes some fluorescence that is activated by the light.

Build : we made brief explanation about our imagination and design.

Test : we did an interview with Pediatrician [Link]

Learn : monitoring body temperature of jaundice patients is a matter of life and death. So reliability matters. And the pediatrician said there is already a reliable product.

Improve : we agreed to change our project target

COVID-19 fever detecting patch

Imagine : COVID-19 occurred. Due to the virus, entering buildings in Korea University, the body temperatures of visitors are monitored. If they are OK, patches are distributed. What if the patches can detect the temperature as well?

Design : We designed a sticker that receives human body temperature as an input, processes the degree of body temperature, and outputs light.

Build : The input is thermal diffusion. How to process and output?

Test : Thermal diffusion was modeled in matlab using the heat transfer equation.

\( {{\delta T} \over {\delta t}} = k \nabla ^2 T \)

[Fig 1. Heat distribution across the patch after 5 minutes attached to human body]

Learn : We found that the heat from human body transfers occurs well.

Improve : We decided to focus on processing and output

Jilin China

Imagine : While looking for a thermosensor-related project at iGEM, we came to the Jilin China project (https://2018.igem.org/Team:Jilin_China). So we decided to introduce this system on our patch system

Design : We designed a patch system that operates in the following stages.
1) Jilin China part expresses mediator protein by heat.
2) The mediator protein triggers the process of inducing the expression of a fluorescent protein or a luciferase.
3) Light generation due to fluorescence or luciferase expression is output.

Build&Test : due to the COVID-19 situation, we couldn’t build and test what we designed. But we did literature research and brainstorming

Learn : It has been shown that various molecules and conditions necessary for cell free expression such as dNTP, amino acids, polymerase, ribosomes, and energy source are required. Considering that our products will be dispensed to the general public, this sophisticated system can hardly be used.

Improve : Literature research was conducted to see if there is a system that requires fewer molecules.

RNA Aptamer

Imagine : While searching for biological systems that can emit various lights, we discovered `RNA aptamer’ and we found a review paper on this.
[Genetically encoded light-up RNA aptamers and their applications for imaging and biosensing, Puchakayala Swetha et al., Journal of Materials Chemistry B, 2020.]

Design : We looked at several systems introduced in the review paper based on 1) Molecules used, 2) Compatibility with our system, 3) Reputation (reliability).

Build : Each team member was assigned a system to be investigated.

Test : Split members gathered at the meeting time introduced investigated system and rated each system according to the set criteria. As a result, the CHA system was chosen as the most appropriate system for us to use.

Learn : The number of molecules used was reduced to three RNA aptamers and the fluorophore DFHBI-1T.

Improve : Our system came to use the CHA system.

Collaboration with Jilin China

Imagine : Although the CHA system exhibits fluorescence, the paper does not tell us how to control the behavior according to temperature.

Design : We decided to introduce a system designed by Jilin China for the behavior according to temperature. Jilin china tried to control the operating temperature by making a hairpin with various loop sequences between complementary SD sequences. However, our sequence was so long that when a complementary sequence was attached and made hairpin structure, the predicted melting temperature was too high.

Build&Test : We sent a mail to Jilin China and asked how they designed the loop sequence, and how they chose RNA candidate. And we also asked for opinions as the experienced on attaching a sequence that is only partially complementary to our target sequence.

Learn : RBS sequence of Jilin china’s system was short enough to make a hairpin structure with appropriate melting temperature. Also, the thermodynamics including the melting temperature predicted by pre-experiment modeling had only 37% accuracy. So we don’t have to fear failures.

Improve : We attached an arbitrary sequence to the end of our target sequence. New nucleotides are consisted of 3-4 base pairs in length complemented to the sequence in the middle of the target sequence.

Attaching part

Imagine : We thought that adding an additional sequence to the target sequence would create an additional hairpin structure and control its behavior according to temperature.

Design : The target sequence is composed as follows.
Target sequence : GACATCTACCAACAGTATCGCTC

The underlined sequence is that binds to H1 and H2. And the other part is that binds only to H1. If the elongated base pairs are complement to the end of the underlined sequence, then it must regulate the affinity between Target sequence and H1.

Build : 3, 4 base pairs are added as below.

Modified Sequences with 3 elongated base pairs
C1	CTGGACATCTACCAACAGTATCGCTC
C2	TGTGACATCTACCAACAGTATCGCTC
C3	GTTGACATCTACCAACAGTATCGCTC
Modified Sequences with 4 elongated base pairs
C4	CTGTGACATCTACCAACAGTATCGCTC
C5	TGTTGACATCTACCAACAGTATCGCTC
C6	GTTGGACATCTACCAACAGTATCGCTC

Test : In order to test the behaviors of the new parts, we need to find proper software or equations.

DNA aptamer

Imagine : Since our CHA system operates based on RNA, we predicted the short lifespan problem due to RNA degradation. To solve this problem, there was an opinion to leave the target sequence as RNA and use a DNA aptamer instead of RNA for subsequent CHA system hairpin sequences.

Design : There were many papers about the use of DNA to aptamer research, so we decided to check about this. A new CHA system composed of DNA aptamers was designed and its advantages and disadvantages were predicted and compared with the existing RNA CHA system.

Build & Test : We investigated how the CHA system works with DNA through the paper.

Learn : Through the paper, we were able to find the sequence of the CHA system that works with DNA, and the method of operation of fluorescence is Fluorophore-Quencher method, not Chemical Fluorophore. When designing a DNA CHA system through discussion, it has the advantage of solving the short-lived problem due to RNA degradation, but since it is a completely different sequence from the RNA sequence we currently designed, the system must be redesigned. There was a disadvantage that the experiment had to be based because there was no information on whether Target RNA – DNA CHA system connection was possible. In addition, even if we changed the CHA system to DNA, we can’t know how long the lifespan problem would be solved because Target sequence is still RNA and it is the key in the operation of the entire system.

Improve : We decided to keep the current RNA CHA system and record the discussion above.

Literature : (1) Real-Time Detection of Isothermal Amplification Reactions with Thermostable Catalytic Hairpin Assembly, Yu (Sherry) Jiang et al., Journal of the american chemical society, 2013. (2) Fast and quantitative differentiation of single-base mismatched DNAby initial reaction rate of catalytic hairpin assembly, Chenxi Li et al., Biosensors and Bioelectronics, 2014. (3) Catalytic Hairpin Assembly Actuated DNA Nanotweezer for Logic Gate Building and Sensitive Enzyme-Free Biosensing of MicroRNAs, Dandan Li et al., Analytical chemistry, 2016.

RNA production

Imagine : Since we have to experiment with the CHA method, we have to get the pure RNA we need for the experiment.

Design : Since we haven't done any method on how to get pure RNA, we did some research to determine how we will experiment.

Build & Test : In the reference paper, when experimenting in vitro, RNA was synthesized and tested through in vitro transcription, and when experimenting in vivo, RNA gene was transformed and tested. In addition, RNA could be ordered and synthesized directly.

Learn : As a result of investigating the cost of the above methods, in vitro transcription was selected because we are doing in vitro experiments and synthesizing RNA was expensive.

Improvement : There are several types of in vitro transcription, among which the in vitro transcription protocol using T7 RNA polymerase was selected. Therefore, the T7 promotor sequence was attached in front of the designed RNA sequence, and the sequence was changed to DNA.

Hairpin - van't hoff equation

Imagine : We can hardly get into our lab. So we need to do some modeling to predict the thermal behavior of our designed parts

Design : If we use van’t hoff equation, it is assumed that we can predict the fraction of certain secondary structures of our RNAs.

Build : I tried to build the graph from van’t hoff equation. K is the ratio that is the fraction of the folded RNA divided by the fraction of the unfolded RNA. f is the fraction of the folded RNA.

Learn : We found that at least one experimental value is needed to draw a graph using van't hoff equation. To know F, we must know K_1 at T_1.

Improve : We needed to find a new method that doesn’t require any experiment. Furthermore, even though we found an initial value from an experiment and plot the van’t hoff graph. We need to do a modeling for hybridization. So the method we designed here is not sufficient.

Hybridization

Imagine : So what we need to do is hybridization modeling not secondary structure modeling.

Details : In Mfold, there is a hybridization of two different strand modeling. [Link]

Experiment Design

Imagine : It was thought that results similar to the modeling values described above would be produced by experiments.

Design & Build: To confirm this, time-scale experiments for each temperature per target C [standard C, Modified Cs] were designed. And graphs will be drawn with the fluorescence intensity for each temperature of each target C. [Link]

Test : Planning to do.

Body temperature measurement

Imagine : In order to observe the color change of the sticker, it must be attached to the outside that is easily visible. Currently, a thermometer that measures body temperature is a method of measuring the temperature inside the body that is mostly covered.

Design : We investigated the locations where body temperature could be measured, and determined which locations could represent body temperature well and could be easily observed.

Build & Test : For the skin temperature to represent the core temperature, the location of the skin to be measured must be near the major vessel or core tissue. For this reason, the locations of the skin commonly used to measure body temperature are the mouth, ears, armpits, and rectum. In the case of the neck, carotid artery, a major vessel, exists under the skin. In addition, two papers could be found saying that the body temperature can be calculated when measuring the skin temperature of the neck.

Learn : Therefore, based on the results of the above two papers, it can be said that the core temperature can be measured through the neck.

Improvement : Our sticker needs to be observed from the outside, and the neck is exposed outside the other positions mentioned above. Therefore, we decided the position to attach the sticker to the neck.

Literatures : (1) NIHR, “Non-contact infrared thermometers”, Horizon Scan Report 0025, November 2013, (2) Denise Landon et al, “12 ways to take a temperature”, www.NursingMadeIncrediblyEasy.com, (3) A Did You Know Poster by Diane L Carroll, PhD, RN, and Donna Furlong, RN, (4) http://www.exodontia.info/Cranial-Temporal-Giant_Cell_Arteritis.html, (5) Venkatesh Selvaraj and Pughal Vendan Gnanaprakasam, "Evaluation of skin temperature over carotid artery for temperature monitoring in comparison to nasopharyngeal temperature in adults under general anesthesia”, Anesth Essays Res. 2016 May-Aug; 10(2): 291–296., (6) Håkan Geijer, Ruzan Udumyan, Georg Lohse, and Ylva Nilsagård, “Temperature measurements with a temporal scanner: systematic review and meta-analysis”, BMJ Open. 2016; 6(3): e009509., (7) C K Suhail, Nandini Dave, Raylene Dias, and Madhu Garasia, “Accuracy of skin temperature over carotid artery in estimation of core temperature in infants and young children during general anaesthesia”, Indian J Anaesth. 2018 Jun; 62(6): 418–423., (8) Pradeep Buddharaju, Ioannis Pavlidis, and Chinmay Manohar, “Face Recognition Beyond the Visible Spectrum”, Advances in Biometrics, pp 157-180