Experiments

1. Preparation

1.1 DNA order

Since in vitro transcription is to be performed using T7 RNA polymerase, a duplex dsDNA template is prepared by attaching the T7 promotor sequence (shown in red) in front of the RNA sequence to be used. DNA was ordered through IDT. The sequences are as follows.

Standard CHA sequence
H1 : TAATACGACTCACTATAG GAGCGATACTGTTGGTAGATGTCGCCATGTCTTGCGACATCTACCAACAGCGAGACAACAGAGAGACGGTCGGGTCCACAGTTTCC
H2 : TAATACGACTCACTATAG GGAAACTGTGTCGAGTAGAGTGTGGGCTCTCTGTTGTCTCGAGATGTCGCAAGACATGGCGACATCTACCAACAGCCATGTCTTG
Standard Target C : TAATACGACTCACTATAG GACATCTACCAACAGTATCGCTC
Modified target C(to be used)
C1 : TAATACGACTCACTATAG CTGGACATCTACCAACAGTATCGCTC
C2 : TAATACGACTCACTATAG TGTGACATCTACCAACAGTATCGCTC
C3 : TAATACGACTCACTATAG GTTGACATCTACCAACAGTATCGCTC
C4 : TAATACGACTCACTATAG CTGTGACATCTACCAACAGTATCGCTC
C5 : TAATACGACTCACTATAG TGTTGACATCTACCAACAGTATCGCTC
C6 : TAATACGACTCACTATAG GTTGGACATCTACCAACAGTATCGCTC
Broccoli sequence(Control) : TAATACGACTCACTATAG GAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTC

1.2 RNA preparation

In vitro transcription with T7 RNA polymerase
In vitro transcription using T7 RNA polymerase is performed to synthesize RNAs (RNA aptamers [H1, H2, Thermosensing RNAs], target RNA sequence).
In vitro T7 transcription is the synthesis of RNAs using a T7 promoter and purified enzyme. It is the standard method of making up to several mg of RNAs longer than about 20nts with relatively high quality as compared to solid phase synthesis.

2. Activity test [Time-scale fluorescence assay]

Using the previously made RNAs (H1, H2, Thermosensing RNAs, target RNA sequence) and Fluorophore (DFHBI-1T), we verify that the CHA system used by our team works well. Also, we verify that the system we designed works by detecting the target temperature of 37.5℃ well.
In all experiments below, H1 and H2 are used at 250nM according to the referenced paper. DFBHI-1T is used at 5 μM according to the paper. Also all experiments are repeated 3 times to calculate the average.

2.1 Conventional CHA system verification

Using standard target C, we are going to confirm that the Standard CHA system works well. Experiment with the same conditions as the paper referenced, and check whether the data appears the same.

2.2 Fluorescence intensity according to temperature

Through a time-scale experiment for each temperature per target C[standard C, Modified Cs], the time for each fluorescence intensity to reach equilibrium is obtained, and at this point, a graph is drawn with the fluorescence intensity for each temperature of each target C.
Through the graph, we check the temperature that the fluorescence intensity starts increasing, and compared the results with that of modeling [Link].
A sample without target C was used as a negative control, and a sample containing only broccoli sequence and a fluorophore was used as a positive control.
Measurements are made for each target C every 10 minutes, from 30℃ to 40℃ at the intervals of 2℃.

Protocol

1. In vitro transcription with T7 RNA polymerase

Materials
Template DNA
Transcription buffer and other components
1X buffer (Make 10X stock, store at -20°C.)
- 50 mM Tris-HCl, pH 7.5
- 15 mM MgCl2
- 5 mM dithiothreitol (DTT)
- 2 mM spermidine
10X NTPs (Store at -20°C.)
- 20 mM each of ATP, CTP, GTP, and UTP
Inorganic pyrophosphatase (optional, 0.1 U/μL stock solution in H2O, store at -20°C.)
T7 RNA polymerase
Method - Transcription reaction
1. For a 100 μL reaction ("preparative scale") Put the following components in the EP tube:
- 10 μL 10X transcription buffer
- 10 μL 10X NTPs
- x μL DNA template (DNA template amount should be 5–10 pmol)
- 5 μL inorganic pyrophosphatase (0.1 U/μL): 0.005 U/μL final concentration
- y μL T7 RNAP (25 U/μL final concentration)
- Add 4DW to 100 μL
2. Incubate reaction at 37 °C for 2 hr.
3. Add 10U of RNase-free DNase I and incubate at 37 °C, 30 min.
4. Add 5 μL of 500 mM EDTA to stop the reaction.
5. Clean-up/process the RNA.

2. RNA Purification by Preparative Polyacrylamide Gel Electrophoresis

Since the length of the RNA to be purified is less than 100nt, a 20% acrylamide gel is used.

Sambrook J, et al. (2001)

Materials
40% acrylamide/bisacrylamide (19:1)
40% acrylamide/bisacrylamide (29:1)
Urea
Tris base
Boric acid (H3BO3)
EDTA
Potassium hydroxide (KOH)
Ammonium persulfate (APS)
N,N,N’,N’ -tetramethylethylenediamine (TEMED)
Formamide
Sodium dodecyl sulfate (SDS)
Bromophenol blue
Xylene cyanol
Ammonium acetate (NH4OAc)
Sodium acetate (NaOAc)
Ethanol
Solutions & buffers
Step 1 10x TBE
- Tris base 890mM 108g
- EDTA, pH 8.0 20mM 40ml (stock 0.5M)
- Boric acid 890mM 55g
- Dissolve Tris and boric acid in ~750 ml of deionized water. Add EDTA. Adjust final volume to 1 L with water. There is no need to adjust the pH of this solution
Native gel mix
- TBE 1x 40ml (stock 10x)
- Acrylamide/bis-acrylamide (29:1) X% (X/40)400ml (stock 40%)
- Ammonium persulfate 0.08% 3.2ml (stock 10%)
- Add deionized water to 400 ml
Denaturing gel mix
- TBE 1x 40ml (stock 10x)
- Acrylamide/bis-acrylamide (19:1) X% (X/40)400ml (stock 40%)
- Urea 6.5M 260ml (stock 10M)
- Ammonium persulfate 0.08% 3.2ml (stock 10%)
- Add deionized water to 400 ml
Step 2 2x Denaturing loading buffer
- Formamide 95% 9.5ml (stock 100%)
- EDTA-KOH, pH 8.0 18mM 360μl (stock 500mM)
- SDS 0.025% 25μl (stock 10%)
- Bromophenol blue 0.05% 5mg
- Xylene cyanol 0.05% 5mg
- Add water to 10ml
5x Nondenaturing loading buffer
- TBE 5x 5ml (stock 10x)
- Glycerol 20% 2ml (stock 100%)
- Bromophenol blue 0.05% 5m
- Xylene cyanol 0.05% 5mg
- Add water to 10ml
Running buffer
- TBE 1x 100ml (stock 10x)
- Deionized water 900ml
Step 4 Elution Solution
- NH4OAc 500mM 250ml (stock 2M)
- EDTA-KOH, pH 8.0 1mM 2ml (stock 500mM)
- Add water to 1L
70% Ethanol (v/v)
- Ethanol 70% 7.3ml (stock 96%)
- Water 2.7ml
Method

Petrov A, et al. (2013)

STEP 1 - PREPARING THE GEL
1.1 Treat gel plates with a siliconizing agent.
1.2 Assemble the gel plates with 1.5mm spacers.
1.3 Prepare the appropriate gel mixture (for native or denaturing gels). The percentage of acrylamide depends on the sizes of the RNA molecules you wish to resolve.
1.4 Add 160μl of TEMED for every 400 ml of the gel mixture to start polymerization. Quickly mix the solution (without introducing air bubbles) and pour the gel. Insert the desired comb and allow the gel to polymerize.
1.5 Mount the gel plates onto the gel running apparatus. Add 1x TBE to both the upper and lower reservoirs. Remove the comb and rinse the wells with 1x TBE using a micropipettor fitted with a gel-loading tip.
1.6 For denaturing gels larger than 20 x 20 cm, clamp an aluminum plate to the front side of the gel plate.
1.7 Prerun denaturing gels at 45–65 V cm^-1 for 30–60 min to equilibrate and preheat the gel. Skip this step for the native gels.

STEP 2 – RUNNING THE GEL
2.1 Mix the RNA sample with the appropriate loading buffer. If running a denaturing gel, add equal volumes RNA sample and 2x denaturing loading buffer. If running a native gel, add 1 volume of 5x nondenaturing loading buffer to 4 volumes of RNA sample.
2.2 Heat the samples for the denaturing gel at 94 C for 5 min.
2.3 Rinse the wells extensively with 1x TBE using micropipettor fitted with a gel-loading tip. Load the samples into the wells.
2.4 Run a denaturing gel at 45–65 V cm^-1; run a native gel at 10–25 V cm^-1.
2.5 Use the mobility of the tracking dyes on the gel to determine when to stop running the gel.

STEP 3 - VISUALIZING THE RNA
3.1 Remove the gel plates from the gel running apparatus. Remove the spacers. Use a metal spatula to pry open the top glass plate of the gel.
3.2 Cover the gel with plastic wrap. Carefully flip the gel plate so that the side with the gel covered in plastic wrap is facing down. Remove the glass plate. Wrap the gel in plastic wrap.
3.3 Place the gel on top of a fluorescent plate and shine UV light on it.
3.4 The RNA will be visible as dark spots on a brightly fluorescing background.

STEP 4 - RNA EXTRACTION USING THE ‘CRUSH AND SOAK’ METHOD
4.1 Cut out the band of interest using a new, clean razor blade.
4.2 Weigh a 50 -ml conical tube and note the weight of the empty tube. Transfer the gel slice into the tube and crush the gel using a disposable pipette.
4.3 Weigh the tube containing the crushed gel slice and calculate the weight of the gel. Add ~2 volumes of Elution Solution (v/w) to the gel.
4.4 Incubate on a tube on a nutator at room temperature for 3 h.
4.5 Centrifuge sample at 5000 x g for 1 min. Collect the supernatant; avoid picking up gel debris. Repeat the centrifugation two more times.
4.6 Add 0.1 volume of 3 M NaOAc, pH 5.2, and 3 volumes of ethanol. Incubate at -20 ℃ for 1 h to precipitate the RNA.
4.7 Collect the RNA by centrifugation at 15 000 rpm for 15 min at 4 ℃. Decant the supernatant and wash the pellet with 70% ethanol.
4.8 Collect the RNA by centrifugation at 15 000 rpm for 15 min at 4 ℃. Decant the supernatant and air-dry the pellet. 4A.9 Resuspend the RNA pellet in water or a desired buffer.
4.9 Resuspend the RNA pellet in water or a desired buffer.

3. Determine the concentration of RNA

RNA concentration measurement is performed using a Nanodrop spectrophotometer.
Protocol
1. Enter Nanodrop spectrophotometer on the PC and select “nucleic acids”
2. Pipette 1-2μl of elution buffer (or D.W) onto the measurement pedestal. [Blank]
3. Absorb the elution buffer with dry, lint-free laboratory wipe.
4. Pipette 1-2μl of sample directly onto the measurement using the software on the PC.
5. Lower the sampling arm and initiate a spectral measurement using the software on the PC.
6. When the measurement is complete, raise the sampling arm and wipe the sample from both the upper and lower pedestals using a dry, lint-free laboratory wipe.
7. data analysis - 260/280 ratio of ~1.8 is generally accepted as “pure” for DNA and a ratio of ~2.0 is generally accepted as “pure” for RNA. For any DNA sample with a 260/280 ratio more than 1.8 indicates the presence of RNA as contamination.

4. Storing RNA

Always store RNA at a neutral pH with some amount of EDTA. Recommend one is TE buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA). Store RNA at -20°C.

5. Time scale fluorescence assay

All the in vitro fluorescence measurements are conducted in a PTI fluorimeter (Horiba, New Jersey, NJ).
RNA molecules are pre-heated at 95°C for 3 min and slowly cooled down to 25°C at the rate of -3°C/min.
Fluorescence assays and RNA assembly reactions are conducted in a buffer consisting of 10mM Tris, 5mM MgCl2, 100mM KCl, and 10mM NaCl at pH=7.5.
250nM H1 and H2 are used for these measurement.
All the reactions are initiated by adding H1 to the mixture and the samples have been incubated for 2 h before taking the measurements.
The kinetic assays are conducted by exciting at 480 nm and collecting the fluorescence data at 500 – 550 nm.
All the data are plotted using the Python software.

References

1) Cazenave C, Uhlenbeck OC. RNA template-directed RNA synthesis by T7 RNA polymerase. Proc Natl Acad Sci U S A. 1994 Jul 19;91(15):6972-6.
2) Alexey Petrov, Tinghe Wu, Elisabetta Viani Puglisi, Joseph D. Puglisi, “RNA Purification by Preparative Polyacrylamide Gel Electrophoresis”, Methods in Enzymology, Volume 530.
3) Aruni P. K. K. Karunanayake Mudiyanselage, Qikun Yu, Mark A. Leon-Duque, Bin Zhao, Rigumula Wu, and Mingxu You, “Genetically Encoded Catalytic Hairpin Assembly for Sensitive RNA Imaging in Live Cells”, Journal of the American Chemical Society, 2018, 140, 8739−8745.
4)https://www.thermofisher.com/document-connect/document-connect.html?url=https%3A%2F%2Fassets.thermofisher.com%2FTFS-Assets%2FCAD%2Fmanuals%2Fts-nanodrop-nucleicacid-olv-r2.pdf&title=TmFub0Ryb3AgTnVjbGVpYyBBY2lkIEhhbmRib29r