Team:Vilnius-Lithuania/Design

Loading...
Design
Design
OVERVIEW

On our journey of helping the aquatic life, we built three pillars on which we founded project FlavoFlow. The first pillar is detection - we designed and produced a simple-to-use pathogenic bacteria detection kit, based on HDA and LFA methodology, which will be of immense help to farmers in quickly and accurately identifying an exact pathogen decimating their aquafarms. The second pillar is a novel bacterial infection treatment system, which uses engineered bacteria to provide a highly specific lysis protein action against the target pathogen without being damaging to the environment. And lastly, the third pillar is a contemporary alginate-contained vaccination solution developed to protect against bacterial and viral fish infections, while also offering precise delivery along with low production, transport and storage costs.

SEE OUR DESIGN FLOW
DETECTION
Detection
Overview

During the past few years, recirculatory aquaculture systems (RAS) became a widely used system for cold-water fish production. With the benefits of these systems, infections also have taken its place. One of the broadest ranges of any fish bacterial pathogens constitutes Flavobacterium columnare and Flavobacterium psychrophilum bacteria, which causes columnariosis and cold-water disease or rainbow trout fry syndrome, respectively. The biggest issue with these diseases is high mortality rates, which often reaches 70 % of the infected fish population only in 24-72 hours1. Due to this rapid spread of infections, there is a massive demand for the point-of-care diagnostic systems, which could identify an exact species of Flavobacterium genus.

Our Flavo detection design is made up of three main steps:

  1. A bioinformatic analysis of the marker gene sequences which does not match between Flavobacterium species. Creation of LFA ssDNA probes and HDA primers.
  2. Helicase-dependent asymmetric DNA amplification (HDA) of the chosen marker gene fragments.
  3. Lateral flow assay (LFA) membrane test based on nucleic acid hybridization that just in a few minutes identifies an exact pathogen.

Bioinformatic Analysis
Bioinformatic Analysis

Since we wanted to differentiate between Flavobacterium species, instead of antibody-antigen interaction, our detection test is based on nucleic acid hybridization. We found out that for identification purposes, nucleic acids are a more reliable and specific source than antibodies2.

The first step in developing a lateral flow assay test based on nucleic acid hybridization is choosing marker genes, which allows us to identify an exact bacteria species. According to our literature research, 16S rRNA gene is a suitable candidate for this purpose because it is present in almost all bacteria and its function did not change over time3. Also, we found that single copy rpoC gene coding β' DNA-dependent RNA polymerase can be used as a marker for F. psychrophilum species4. As well as cslA gene coding chondroitin AC lyase for F. columnare species5.

After choosing marker sequences to identify specific Flavobacteria, we focused on lateral flow assay test development. To do this, we created three single-stranded DNA (ssDNA) probes: detection and capture probes that would hybridize to the amplified fragment of the marker gene as well as the control probe.

The detection probe is used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by the gold nanoparticle. If the probe sequence is unmodified then after conjugation with the gold nanoparticle it can lose its molecular recognition function6. For this reason, a poly-A sequence followed by the thiol group (ThioMC6-D, IDT) is added to the 5' end and the rest of the sequence is left free for hybridization.

The capture probe also has a 3' modification of poly-A to make sure that the probe sequence itself is available for hybridization followed by biotin moiety (bio, IDT). Biotin modification is needed so that the probe could be immobilized on the test line of the lateral flow assay test strip via biotin-streptavidin non-covalent interaction. Control probe has a 5' biotin moiety (biosg, IDT) for the same reason as well.

In our case, the detection and capture probes were created to be complementary to the negative strand of the gene (table 1). Control probe is complementary only to the detection probe.

After creating ssDNA probes for lateral flow assay, primers for HDA meant to amplify fragments with probe hybridization sites were created using the IDT PrimerQuest tool and following manufacturers recommended parameters: GC % 30 - 60%, Tm 60°C - 80°C, size 20 - 35 bp.

Table 1. Detection and capture probe placement on the DNA strand. Underlined sequence part marks HDA primers placement.

SpeciesDetection probe & Capture probe
F. columnare 16S rRNA geneCAGGGGGATAGCCCAGAGAAATTTGGATTAATACCCCATAGTATTTTCAGATGGCCTCATTTGATTATTAAAGTTCCAACGGTACAAGATGAGCATGCGTCCCATTAGCTAGTTGGTGTGGT
F. columnare cslA geneAATGACTTCAACTAGAACAGTAGGTGCTGAAGCAGGTAATAATTCAGGGAATTATAACTATTATGCAGGGGCAGGAGTGAATTACACAATTCATA
F. psychrophilum 16S rRNA geneGGATAGCCCAGAGAAATTTGGATTAATACCTCATAGTATAGTGAGTTGGCATCAACACACTATTAAAGTCACAACGGTAAAAGATGAGCATGCGTCCCATTAGCTAGTTG
F. psychrophilum rpoC geneACGGGTATTCTTCTTGCTACAAATAATATTCCTTACGGTTCAAGTATTTATG
TAAATGACGCTCAAGTTGTAGAAAAAGGAGATGTTATTTGTAAATGGGATCC
Helicase-dependent amplification
Helicase-dependent amplification

With the aim to create a rapid, specific and cost-effective point-of-care detection system, at first, we needed to find the most suitable isothermal DNA amplification method. This method should be usable for farmers who have no scientific background. This factor pinpoints a huge need to be able to perform these isothermal reactions with as minimal pipetting steps as possible by means of avoiding errors and false-positive results. Although, amplification of marker sequences should be done in constant temperature by the needs of cheap and fully-portable equipment.

By leading these main requirements, we have distinguished some isothermal amplification methods such as helicase-dependent amplification (HDA), loop-mediated isothermal amplification (LAMP), strand-displacement amplification (SDA) and rolling circle amplification (RCA)7.

However, LAMP, SDA or RCA amplification methods have their own limitations such as complicated reaction schemes or multiplex sets of primers. Also, it should be mentioned that each of these methods are incapable of amplifying DNA targets of sufficient length required for lateral flow assay test8.

After further analysis, we found out that in order to fulfil these goals, helicase-dependent amplification would be a perfect solution. This method allows us to make our detection test as specific as possible by using an exact length of target sequences. Thus, it provides a simple reaction scheme and enables the generation of single-stranded DNA fragments, which are essential for lateral flow assay test development9.

Helimerase
WZB1WZA2TteUvrDBstPolStrepII Tag10xHis TagMBP TagL1L1
Helimerase

However, regarding the WHO guidelines for point-of-care testing, our detection tool should not only be sensitive, specific and user-friendly but also it should be affordable for target customers10. Keeping in mind that HDA amplification, performed using a commercial kit, is still too expensive, we have decided to search for new alternatives to reduce the cost of the test as much as possible.

Our solution to this problem - helimerase. This protein complex contains two enzymes - Thermoanaerobacter tengcongensis UvrD helicase (TteUvrD) and Bacillus stearothermophilus DNA polymerase I large fragment (BstPol). TteUvrD is fused with one part of coiled-coil structure WinZip-A2 (WZA2) via linker L1 and possesses a maltose-binding protein (MBP) and 10xHis Tag in the N terminal end. BstPol is fused with the second coiled-coil part WinZip-B1 (WZB1) through linker L1 and possesses StrepII tag in the N terminal end11. It was presumed that this non-covalent fusion strategy through coiled-coil structures should improve HDA reaction by letting to amplify longer DNA fragments as well as it allows to perform amplification reaction without using additional proteins such as MutL or others SSB proteins, which are used in such kind of reactions11,12.

Lateral Flow Assay
Lateral Flow Assay

However, a method to visualize HDA amplification results is still needed because in remote locations methods such as electrophoresis are not feasible. To solve this problem, we decided to choose lateral flow assay (LFA). The use of the test is very intuitive, requiring no prior training and can be used for isothermal amplification results visualisation. Also, this LFA test is cost-effective and portable. Because of this, it is commonly used in remote locations where access to scientific laboratories is limited. For these reasons, we have decided that the best strategy for rapid flavobacterium-caused infection detection tool development is the combination of HDA and LFA methods.

TREATMENT
Treatment

After detection of an exact Flavobacterium species, farmers need to start an exact treatment process as soon as possible. Currently, fish infected with flavobacterial diseases are treated with different types of antibiotics28. Scientific data shows35 that the most abundant antibiotic used for salmon cultivation was quinolone, whose consumption (by mass) in 2007 reached 821,997 tonnes. And that is only in Norway! Other commonly used antibiotics in farms are oxolinic acid and florfenicol, whose consumption reached 681 kg in 2008 and 166 kg in 2010 respectively. This enormous usage of a broad range of antibiotics forces the evolving of antibiotic-resistant bacterial fish pathogens. It is quite evident that these numbers raise huge concerns and questions on how we can reduce the usage of antibiotics?

Scientific data already shows that some F. psychrophilum isolates already have reduced susceptibility to quinolones, oxolinic acid, and enrofloxacin16. To reduce the amount of antibiotics used in aquaculture farms, our second goal is the development of two exogenous fish infection treatment systems, which are based on quorum sensing mechanisms. The treatment section fulfils our project main idea - Detection and offers an alternative way of fighting with pathogenic infections.

Flavobacterial diseases occur when Flavobacterium forms a biofilm on fish fins or gills30. Our target bacteria - Flavobacterium uses signalling molecules for cell-cell communication. Quorum sensing is a bacterial communication process that leads to the regulation of genes and response to changes17–19. The quorum sensing has two distinguished systems - AHL and AI-2 for Gram-negative bacteria for now19–21. We used the circumstances to our advantage: build two genetic circuits that are enhanced by quorum sensing signalling molecules. Both synthetic biological systems are for exolysin synthesis, the difference is how transporter cell lyses itself. Thus, we are introducing three different strength AI-2 inducible promoters: a native lsrACDBFG (K3416000) and two mutated ones EP01r (K3416001) and EP14r (K3416014).

Choose treatment system
Endolysin & Exolysin System
Toxin & Antitoxin System
Endolysin & Exolysin System
Toxin & Antitoxin System

Our priority plan was to use flavobacterial phage lysins and to test it on a specific bacteria species. But we were unable to acquire neither a phage nor a lysin nor its gene sequence because there is so little research and discoveries made on aquatic phage exolysins31.

Luckily, we found that in the Life Sciences Center, Vilnius, Lithuania experiments are being conducted on Klebsiella KV-3 phage’s RAK-2 exolysins. Exolysin gene and Klebsiella pneumoniae bacteria were kindly provided for us to use by R.Meškys.

You may ask what is similar between Klebsiella pneumoniae and Flavobacterium columnare, Flavobacterium branchiophilum, or Flavobacterium psychrophilum.

First of all, Klebsiella pneumoniae is gram-negative as well as other many pathogenic fish diseases causing bacteria including Flavobacterium species.

Secondly, to form a biofilm K. pneumoniae uses the same quorum-sensing molecule – autoinducer-226

Thirdly, it has a similar structure to Flavobacterium, which uses a bacterial capsule as its virulence factor.

Lastly, like many other pathogenic bacteria both Flavobacterium species and K.pneumoniae can form biofilms27.

PREVENTION
Prevention

Usually, in order to prevent fish infections, vaccines are injected intraperitoneally. Because of manual handling, which is unavoidable in such a type of vaccination, fish experience a lot of stress and it paradoxically weakens their immune system52. With the aim to avoid such consequences, we have set the third goal - to create a prevention system based on subunit vaccines against bacterial and viral fish infections.

Subunit vaccines
References

References

  1. Loch, T. P. & Faisal, M. Emerging flavobacterial infections in fish: A review. Journal of Advanced Research vol. 6 283–300 (2015).
  2. Chen, A. & Yang, S. Replacing antibodies with aptamers in lateral flow immunoassay. Biosensors and Bioelectronics vol. 71 230–242 (2015).
  3. Janda, J. M. & Abbott, S. L. 16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: Pluses, perils, and pitfalls. Journal of Clinical Microbiology vol. 45 2761–2764 (2007).
  4. Strepparava, N., Wahli, T., Segner, H. & Petrini, O. Detection and quantification of Flavobacterium psychrophilum in water and fish tissue samples by quantitative real time PCR. http://www.biomedcentral.com/1471-2180/14/105 (2014).
  5. Mabrok, M. et al. Development of a species-specific polymerase chain reaction for highly sensitive detection of Flavobacterium columnare targeting chondroitin AC lyase gene. Aquaculture 521, (2020).
  6. Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Analytical Methods vol. 9 2633–2643 (2017).
  7. Zaghloul, H. & El-Shahat, M. Recombinase polymerase amplification as a promising tool in hepatitis C virus diagnosis. World Journal of Hepatology vol. 6 916–922 (2014).
  8. Vincent, M., Xu, Y. & Kong, H. Helicase-dependent isothermal DNA amplification. EMBO Reports 5, 795–800 (2004).
  9. Kolm, C. et al. Detection of a microbial source tracking marker by isothermal helicase-dependent amplification and a nucleic acid lateral-flow strip test. Scientific Reports 9, (2019).
  10. Kosack, C. S., Page, A. L. & Klatser, P. R. A guide to aid the selection of diagnostic tests. Bulletin of the World Health Organization 95, 639–645 (2017).
  11. Motré, A., Li, Y. & Kong, H. Enhancing helicase-dependent amplification by fusing the helicase with the DNA polymerase. Gene 420, 17–22 (2008).
  12. Jeong, Y. J., Park, K. & Kim, D. E. Isothermal DNA amplification in vitro: the helicase-dependent amplification system. Cellular and molecular life sciences : CMLS vol. 66 3325–3336 (2009).
  13. Perez, D., Sandra, P., Giannina, B. and Caterina, R. Nucleic-Acid Lateral Flow Assay Optimization with Different Gold Nanoparticle Size for Detection of Pathogen after PCR, Using L. Monocytogenes as Model. Acta Scientific Microbiology, 1(10), 17-24 (2018).
  14. Liu, B. and Liu, J., Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Analytical Methods, 9(18), 2633-2643 (2017).
  15. Zhang, X., Servos, M. and Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. Journal of the American Chemical Society, 134(17), 7266-7269 (2012).
  16. Saticioglu, I. B. Antimicrobial resistance and resistance genes in Flavobacterium psychrophilum isolates from Turkey. 8 (2019).
  17. Xavier, K. B. et al. Phosphorylation and Processing of the Quorum-Sensing Molecule Autoinducer-2 in Enteric Bacteria. ACS Chem. Biol. 2, 128–136 (2007).
  18. Papenfort, K. & Bassler, B. L. Quorum sensing signal–response systems in Gram-negative bacteria. Nat Rev Microbiol 14, 576–588 (2016).
  19. Stephens, K. & Bentley, W. E. Synthetic Biology for Manipulating Quorum Sensing in Microbial Consortia. Trends in Microbiology 28, 633–643 (2020).
  20. Waters, C. M. & Bassler, B. L. QUORUM SENSING: Cell-to-Cell Communication in Bacteria. 31 (2005).
  21. Ahmer, B. M. M. Cell-to-cell signaling in Escherichia coli and Salmonella enterica: Quorum sensing in E. coli and Salmonella. Molecular Microbiology 52, 933–945 (2004).
  22. Barnes, M. E. A Review of Flavobacterium Psychrophilum Biology, Clinical Signs, and Bacterial Cold Water Disease Prevention and Treat. TOFISHSJ 4, 40–48 (2011).
  23. Federle, M. J. Autoinducer-2-Based Chemical Communication in Bacteria: Complexities of Interspecies Signaling. in Contributions to Microbiology (eds. Collin, M. & Schuch, R.) vol. 16 18–32 (KARGER, 2009).
  24. Pereira, C. S., Thompson, J. A. & Xavier, K. B. AI-2-mediated signaling in bacteria. FEMS Microbiol Rev 37, 156–181 (2013).
  25. Sun, J., Daniel, R., Wagner-Döbler, I. & Zeng, A.-P. Is autoinducer-2 a universal signal for interspecies communication: a comparative genomic and phylogenetic analysis of the synthesis and signal transduction pathways. BMC Evol Biol 4, 36 (2004).
  26. Balestrino, D., Haagensen, J. A. J., Rich, C. & Forestier, C. Characterization of Type 2 Quorum Sensing in Klebsiella pneumoniae and Relationship with Biofilm Formation. J. BACTERIOL. 187, 11 (2005).
  27. Vuotto, C. et al. Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol 123, 1003–1018 (2017).
  28. Manage, P. M. Heavy use of antibiotics in aquaculture: Emerging human and animal health problems – A review. Sri Lanka J. Aquat. 23, 13 (2018).
  29. Fursov, M. V. et al. Antibiofilm Activity of a Broad-Range Recombinant Endolysin LysECD7: In Vitro and In Vivo Study. Viruses 12, 545 (2020).
  30. Levipan, H. A. & Avendaño-Herrera, R. Different Phenotypes of Mature Biofilm in Flavobacterium psychrophilum Share a Potential for Virulence That Differs from Planktonic State. Front. Cell. Infect. Microbiol. 7, (2017).
  31. Castillo, D. & Middelboe, M. Genomic diversity of bacteriophages infecting the fish pathogen Flavobacterium psychrophilum. FEMS Microbiology Letters 363, fnw272 (2016).
  32. Zhang, Y. et al. MazF Cleaves Cellular mRNAs Specifically at ACA to Block Protein Synthesis in Escherichia coli. Molecular Cell 12, 913–923 (2003).
  33. Knecht, L. E., Veljkovic, M. & Fieseler, L. Diversity and Function of Phage Encoded Depolymerases. Front. Microbiol. 10, 2949 (2020).
  34. Latka, A., Maciejewska, B., Majkowska-Skrobek, G., Briers, Y. & Drulis-Kawa, Z. Bacteriophage-encoded virion-associated enzymes to overcome the carbohydrate barriers during the infection process. Appl Microbiol Biotechnol 101, 3103–3119 (2017).
  35. Burridge, L., Weis, J. S., Cabello, F., Pizarro, J. & Bostick, K. Chemical use in salmon aquaculture: A review of current practices and possible environmental effects. Aquaculture 306, 7–23 (2010).
  36. Hansson, M., Nygren, P.-A. & Ståhl, S. Design and production of recombinant subunit vaccines. Biotechnology and Applied Biochemistry 32, 95–107 (2000).
  37. Holten-Andersen, L., Doherty, T. M., Korsholm, K. S. & Andersen, P. Combination of the Cationic Surfactant Dimethyl Dioctadecyl Ammonium Bromide and Synthetic Mycobacterial Cord Factor as an Efficient Adjuvant for Tuberculosis Subunit Vaccines. Infection and Immunity 72, 1608–1617 (2004).
  38. Shin, C., Kang, Y., Kim, H.-S., Shin, Y. K. & Ko, K. Immune response of heterologous recombinant antigenic protein of viral hemorrhagic septicemia virus (VHSV) in mice. Anim Cells Syst (Seoul) 23, 97–105 (2019).
  39. Nelson, S. S., Bollampalli, S. & McBride, M. J. SprB Is a Cell Surface Component of the Flavobacterium johnsoniae Gliding Motility Machinery. Journal of Bacteriology 190, 2851–2857 (2008).
  40. Maurice, S., Nussinovitch, A., Jaffe, N., Shoseyov, O. & Gertler, A. Oral immunization of Carassius auratus with modified recombinant A-layer proteins entrapped in alginate beads. Vaccine 23, 450–459 (2004).
  41. Béarzotti, M. et al. The glycoprotein of viral hemorrhagic septicemia virus (VHSV): antigenicity and role in virulence. Veterinary Research 26, 413–422 (1995).
  42. Mt, H. Technical aspects of the administration of vaccines. Dev Biol Stand 90, 79–89 (1997).
  43. Midtlyng, P. J. et al. Three Rs approaches in the production and quality control of fish vaccines. Biologicals 39, 117–128 (2011).
  44. Kwon, K.-C., Lamb, A., Fox, D. & Porphy Jegathese, S. J. An evaluation of microalgae as a recombinant protein oral delivery platform for fish using green fluorescent protein (GFP). Fish & Shellfish Immunology 87, 414–420 (2019).
  45. Lee, K. Y. & Mooney, D. J. Alginate: properties and biomedical applications. Prog Polym Sci 37, 106–126 (2012).
  46. ALGINATE. Fao.org at http://www.fao.org/3/y4765e/y4765e08.htm
  47. Xu, F., Wang, P., Zhang, Y.-Z. & Chen, X.-L. Diversity of Three-Dimensional Structures and Catalytic Mechanisms of Alginate Lyases. Appl. Environ. Microbiol. 84, (2018).
  48. Tavafi, H., Abdi- Ali, A. A., Ghadam, P. & Gharavi, S. Screening of Alginate Lyase-Producing Bacteria and Optimization of Media Compositions for Extracellular Alginate Lyase Production. Iran Biomed J 21, 48–56 (2017).
  49. Gupta, S. et al. Macroalga-Derived Alginate Oligosaccharide Alters Intestinal Bacteria of Atlantic Salmon. Front Microbiol 10, (2019).
  50. Caswell, R. C., Gacesa, P., Lutrell, K. E. & Weightman, A. J. Molecular cloning and heterologous expression of a Klebsiella pneumoniae gene encoding alginate lyase. Gene 75, 127–134 (1989).
  51. Sepúlveda, D. et al. Time-course study of the protection induced by an interferon-inducible DNA vaccine against viral haemorrhagic septicaemia in rainbow trout. Fish & Shellfish Immunology 85, 99-105 (2019).
  52. de Kinkelin, P. et al. Eighteen years of vaccination against viral haemorrhagic septicaemia in France. Vet. Res. 26, 379–387 (1995).