Team:Vilnius-Lithuania/Results
Goal - To create an LFA test that can be used for F. columnare and F. psychrophilum species specific HDA amplicon identification in the farm. As well as to enhance HDA efficiency by using a binary helimerase complex.
Results - The test created for F. psychrophilum worked as we expected and was able to positively identify only F. psychrophilum species, whereas specificity of F. columnare test was lower and potentially could lead to false positive results. Proteins, synthesized for helimerase showed activity, however they did not form electrostatic interactions in vivo or in vitro.
Future directions - To improve overall performance of the test, experiments are needed to intensify the colour of the test and control lines as well as specificity of F. columnare LFA test. This could be achieved by doing sample dilutions or testing a different marker gene. Also, further optimization of TteUvrD and BstPol proteins interaction in vivo and in vitro needs to be done with the aim to enhance HDA amplification efficiency.
Infections caused by Flavobacterium genus spread incredibly fast and are of an immense threat to aquaculture farms. For this reason, it's crucial to detect F. columnare or F. psychrophilum caused infections as soon as possible. However, majority of the time this identification is delayed and causes huge losses for aquaculture farms. To solve this issue, we decided to create a rapid detection tool based on helicase dependent amplification (HDA) and lateral flow assay test (LFA).
Since we decided to base our detection system on nucleic acid hybridization, the first crucial step was to find unique marker genes for each Flavobacterium species. 16S ribosomal RNA gene (AY577821) was selected for F. columnare (ATCC 23463) strain. Whereas rpoC gene (JX657167.1) was chosen for F. psychrophilum (ATCC 49418) strain1.
To make sure that the test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1.2.4.). Probe placement for F. columnare was selected based on the absence of matching alignments between sequences (Fig. 1). For the rpoC gene, meant to identify F. psychrophilum we chose 205 - 250 bp region to place detection and capture probes.
Figure 1. Flavobacterium species 16S rRNA partial gene sequences alignment. Black boxes highlight sequence parts chosen for probe placement. Gene sequences: F. columnare - AY577821, F. branchiophilum - AB680752, F. psychrophilum - AY662493.
ssDNA probes were created for the chosen regions in marker genes (Table 1). Detection and capture probes were created to be complementary to the negative strand of the DNA. Control probe is complementary to the detection probe. ssDNA probes for F. columnare were created according to parameters proposed in the research paper2. When creating probes for F. psychrophilum we decided to make them longer and of greater GC-content in hopes that hybridization reaction in the LFA test would be improved.
| Species | Probe type | Sequence and its modification | Location | Parameters |
|---|---|---|---|---|
| F. columnare 16S rRNA gene | Detection probe | ThioMC6-D-(A)20-TTTCAGATG | 172 - 180 bp | Tm = 15.4°C GC% = 33.3% size = 29 nt |
| Capture probe | GCCTCATTTGATT-(A)20-bio | 181 - 193 bp | Tm = 36.5°C GC% = 38.5% size = 33 nt | |
| Control probe | biosg-(A)20-CATCTGAAA | - | Tm = 15.4°C GC% = 33.3% size = 29 nt | |
| F. psychrophilum rpoC gene | Detection probe | ThioMC6-D-(A)20-ATTCCTTACGGTTCAAGTAT | 205 - 224 bp | Tm = 48.5°C GC% = 35% size = 40 nt |
| Capture probe | AAATGACGCTCAAGTTGTAG-(A)20-bio | 231 - 250 bp | Tm = 48.5°C GC% = 35% size = 40 nt | |
| Control probe | biosg-(A)20-ATACTTGAACCGTAAGGAAT | - | Tm = 48.5°C GC% = 35% size = 40 nt |
Table 1. Parameters of ssDNA probes created for nucleic acid lateral flow assay test. Tm and GC% was calculated without poly-A sequence using IDT oligo analyzer tool. (A)20 marks poly-A sequence of 20 adenines. Bio and Biosg means biotin modification and ThioMC6-D - Thiol group modification at appropriate ends of the sequence.
After exact placement of probes was known, primers for HDA were created to make sure that the amplicon will have necessary detection and capture probe hybridization sites (Table 2). Primers were made using IDT primer quest tool. Blast analysis results showed that amplicons are specific only to the exact species of bacteria we wanted to identify.
| Primer | Amplicon | |||||
|---|---|---|---|---|---|---|
| bp | GC% | Tm, °C | bp | Tm, °C | ||
| Recommended parameter ranges for HDA | 20-35 | 30-60 | 60-80 | 70-120 | 68-77 | |
| CAGGGGGATAGCCCAGAGAAATTTGG | F_Col | 26 | 53.8 | 73.9 | 122 | 75 |
| ACCACACCAACTAGCTAATGGGACGC | R_Col | 26 | 53.8 | 72.2 | ||
| ACGGGTATTCTTCTTGCTACAAATA | F_Psy | 25 | 36.0 | 62.9 | 104 | 70 |
| GGATCCCATTTACAAATAACATCTCC | R_Psy | 26 | 38.5 | 65.3 | ||
Table 2. Used primers and amplicons parameters. Calculations were made using the Thermo Fisher multiple primer analyzer tool. All parameters are in the ranges suggested by HDA amplification kit manufacturers.
Symmetric and asymmetric HDA as well as PCR were performed with the created primers (Fig. 2). PCR amplification using F. psychrophilum gDNA as a template and F_Psy, R_Psy primers proved to be specific to species (Fig. 2, C). In contrast, PCR amplification of F. columnare gDNA fragment with F_Col and R_Col primers showed less specificity than we imagined (Fig. 2, A). Nonetheless both asymmetric amplifications were successful and the average concentration of ssDNA was 2.53-2.96 μM as measured by qubit fluorometer.
Also, HDA amplification with F. psychrophilum gDNA was successful and the product could be seen in a gel (Fig. 2, B). On the other hand HDA using F. columnare gDNA as a template proved to be difficult to perform and improve. Even though the product could not be seen in a gel after electrophoresis, by using qubit fluorometer we determined that the average concentration of amplicon after symmetric and asymmetric HDA was around 0.7 μM for both species. This concentration is lesser than we expected but still suitable to be detected by the LFA test.
Figure 2. Left to right: A. L - gene ruler 50 bp ladder (SM0371), 1 - F. columnare symmetric PCR with F_Col and R_Col primers, 2 - F. psychrophilum symmetric PCR with F_Col and R_Col primers, 3 - E. coli symmetric PCR with F_Col and R_Col primers, 4 - F. columnare asymmetric PCR with F_Col and R_Col primers (1:15), B. L - gene ruler 50 bp ladder (SM0371), 5 - F. columnare symmetric HDA, 6 - F. psychrophilum symmetric HDA, C. 7- F. psychrophilum symmetric PCR with F_Psy and R_Psy primers , 8 - F. columnare symmetric PCR with F_Psy and R_Psy primers, 9 - E. coli symmetric PCR with F_Psy and R_Psy primers, 10 - F. psychrophilum asymmetric PCR with F_Psy and R_Psy primers (1:15), L - gene ruler 50 bp ladder (SM0371). After amplification with F_Col and R_Col primers fragment size should be 122 bp and for F_Psy, R_Psy - 104 bp.
Created detection probes (Table 1) need to be immobilized on the gold nanoparticles. We decided to chemically synthesize these 13 nm gold nanoparticles using a modified Turkevich method. Synthesized AuNP were characterized by using NanoSight NS300 instrument. The results showed that the mode of size for gold nanoparticles was 25.4 nm. The size is greater than expected but some slight variation can be present using such characterization method.
To get the most accurate results, analysis using dynamic light scattering and transmission or scanning electron microscopy should be performed as well. We concluded that synthesized gold nanoparticles were of suitable parameters for further functionalization reactions.
During the functionalization reaction, ssDNA detection probes are conjugated to the gold nanoparticle itself. Since created probes had a poly-A sequence, a low pH assisted method was used. No change in colour of the gold nanoparticles solution during NaCl test indicated a lack of aggregation and successful functionalization reaction. However, a more appropriate evaluation method was required.
For this reason absorption spectrum of nanoparticles before and after functionalization was determined (Fig. 3). Before functionalization gold nanoparticles had an absorption peak at 522 nm whereas after conjugation to F. columnare or F. psychrophilum detection probes, absorption peak shifted to 527 and 529 nm respectively. This shift is expected and indicates a successful functionalization reaction2.
Figure 3. Gold nanoparticles (Au-NP) absorption spectra determined with UV-Visible spectrophotometry. Blue line indicates nanoparticles absorption before conjugation to detection probes, yellow line - after functionalization with F. psychrophilum probes whereas orange line shows absorption after functionalization with F. columnare detection probes.
Finally, having all necessary reagents and membranes, the LFA tests were assembled (Fig. 4). Functionalized gold nanoparticles can be found in the conjugate pad. Capture and control probes were sprayed on the test line and control line respectively. After this we had two sets of tests created to identify F. columnare and F. psychrophilum. Different running buffers were tested and it was determined that running buffer II (10X SSC, 3.5% Triton X-100, 0.25% SDS, 12.5% formamide) was the most suitable since tests resulted in the most clearly visible red lines. The next step was to evaluate specificity and accuracy.
Figure 4. LFA test dimensions.
At first the LFA test using 16S ribosomal RNA gene was created to identify F. psychrophilum but its specificity was low and could not be improved, meaning that the test became positive using amplicons other than F. psychrophilum. However, a redesigned test using the rpoC gene proved to be more specific and was able to differentiate F. psychrophilum from F. columnare as well as from E. coli and F. piscis (Fig. 5). These results meant that the test can be used for accurate F. psychrophilum species identification.
Figure 5. Specificity experiment of F. psychrophilum identification LFA test. Tests were evaluated using 100 nM of DNA in 100 μL of running buffer II. 1 - F. psychrophilum asymmetric HDA with F_Psy and R_Psy primers, 2 - F. psychrophilum symmetric HDA with F_Psy and R_Psy primers after denaturation, 3 - F. psychrophilum asymmetric PCR with F_Psy and R_Psy primers, 4 - F. psychrophilum symmetric PCR with F_Psy and R_Psy primers after denaturation, 5 - F. psychrophilum asymmetric PCR with F_Col and R_Col primers, 6 - F. columnare asymmetric PCR with F_Psy and R_Psy primers, 7 - F. piscis asymmetric PCR with F_Psy and R_Psy primers, 8 - E. coli asymmetric PCR with F_Psy and R_Psy primers, 9 - no DNA template. CL indicates control line, TL - test line.
However, the LFA test created for F. columnare identification showed less exciting results (Fig. 6). We determined that it was able to differentiate between F. psychrophilum and F. columnare as well as F. piscis but was unable to distinguish F. columnare from E. coli. This can lead to false positive results. In the future further optimization experiments should be performed to see if specificity of the test could be improved.
Also, in silico created ssDNA probes using cslA gene for F. columnare identification should be tested. Nonetheless, as a control experiment we tested F. columnare amplicon on the LFA test created using F. branchiophilum 16S rRNA gene and saw no positive results indicating that in the future LFA test for F. branchiophilum species identification could be created.
Figure 6. Specificity experiment of F. columnare identification LFA test. Tests were evaluated using 100 nM of DNA in 100 μL of running buffer II. 1 - F. columnare asymmetric HDA with F_Col and R_Col primers, 2 - F. columnare symmetric HDA with F_Col and R_Col primers after denaturation, 3 - F. columnare asymmetric PCR with F_Col and R_Col primers, 4 - F. columnare symmetric PCR with F_Col and R_Col primers after denaturation, 5 - F. columnare asymmetric PCR with F_Psy and R_Psy primers, 6 - F. psychrophilum asymmetric PCR with F_Col and R_Col primers, 7 - F. piscis asymmetric PCR with F_Col and R_Col primers, 8 - E. coli asymmetric PCR with F_Col and R_Col primers, 9 - F. columnare asymmetric PCR with F_Col and R_Col primers on the test created for F. branchiophilum identification, 10 - no DNA template. CL indicates control line, TL - test line.
After testing specificity we aimed to determine the lowest amount of detectable DNA by F. psychrophilum identification test (Video 1). To do this we used serial dilutions. As seen in a timelapse, the lowest amount of DNA detected was around 15 nM, because the test line was still visible. F. columnare LFA test showed similar results. This detection limit is sensitive enough to identify fragments amplified during HDA even if this amplification is not as efficient as PCR.
Video 1. Timelapse of F. psychrophilum LFA test (lower) and control (higher) lines development using serial dilutions of DNA. The starting amount was 500 nM followed by 250 nM, 125 nM, 62.5 nM, 31.25 nM, 15.63 nM, 7.81 nM, 3.91 nM, 1.95 nM, 0.98 nM, 0.45 nM, 0 nM.
Vilnius-Lithuania 2020 iGEM team results show that HDA-LFA based detection tool can be developed to identify specific Flavobacterium genus species. In the future further optimization must be performed to improve this detection tool. Optimizations using our onFlow software could help in improving test and control lines colour intensity as well as specificity. In addition onFlow will help in the process of creating a quantitative LFA. Also, to minimize wastage LFA with multiple test lines for different species identification could be created. In hopes that future iGEM teams will find our project useful and will try to improve on it. All ssDNA probes can be found as DNA parts in the iGEM repository.
However, according to WHO recommendations on the point-of-care diagnostic systems development, one of the criteria is its low price3. To fulfil this criteria we found a significantly cheaper alternative for HDA assay – the helimerase.
Helimerase – is a bifunctional protein complex, made up of two enzymes - BstPol and TteUvrD. These proteins are physically linked to each other through the coiled-coil structure. TteUvrD helicase is fused with one part of this structure, WinZip-A2 (WZA2), through the linker L1 and is positioned in the N-terminal end of the sequence. The research has shown that this type of coiled-coils structures provide predictable tertiary structure and stability4.
Firstly gene sequence WZA2-L1-TteUvrD (Fig. 7A.) was cloned into pETDuet vector. This protein was fused with a 10xHis tag and a maltose binding protein (MBP) at N-terminus. Analogously, WZB1-L1-BstPol (Fig. 7B.) gene was cloned into the second MCS of pACYC plasmid and fused with StrepII tag at the N-terminus.
Figure 7. Helimerase structure. A - TteUvrD helicase fused with one part of coiled-coil structure WinZip-A2(WZA2) through the linker L1; B - Bst polymerase I large fragment (BstPol) fused with one part of coiled-coil structure WinZip-B1(WZB1) through the linker L1.
The optimal expression conditions for WZA2-L1-TteUvrD and WZB1-L1-BstPol was observed in E. coli BL21(DE3) strain after 16 hours induction with 1 mM IPTG at 30 °C. Both proteins were purified under native conditions.
WZA2-L1-TteUvrD protein was purified by using Ni-NTA affinity column. The concentration of recombinant protein observed after purification under native conditions from 1 L medium reached 5.5 mg/ml. However, as seen in SDS-PAGE gel, further optimization procedures are needed to remove impurities. Yield of WZB1-L1-BstPol obtained after purification from 1 L medium was 2.2 mg/ml (Fig. 8).
Figure 8. SDS-PAGE electrophoresis after WZA2-L1-TteUvrD (136.598 kDa) and WZB1-L1-BstPol (74.225 kDa) purification. L - PageRuler Plus Prestained Protein Ladder (#26620), 1 - WZA2-L1-TteUvrD supernatant, 2 - WZA2-L1-TteUvrD 3 elution fraction, 3 - WZA2-L1-TteUvrD 5 elution fraction, 4 - WZA2-L1-TteUvrD 14 elution fraction, 5 - WZA2-L1-TteUvrD after protein concentration, 6 - WZB1-L1-BstPol supernatant, 7 - WZB1-L1-BstPol 4 elution fraction, 8 - WZB1-L1-BstPol 6 elution fraction, 9 - WZB1-L1-BstPol 7 elution fraction, 10 - WZB1-L1-BstPol after protein concentration.
To verify that WZA2-L1-TteUvrD and WZB1-L1-BstPol proteins are stable at high temperatures we performed fluorescence thermal shift assay by utilizing a thermodynamic model5. This measurement is based on protein property to unfold upon increasing temperature of environment and solvatochromic property of fluorescence dye to fluorescent more intensively in the hydrophobic environment6. The results (Fig. 9A and Fig. 9B) show that both proteins are stable at high temperatures, thus letting us use them in activity assays. Also, according to obtained melting temperatures (TM) WZB1-L1-BstPol enzyme is more stable and starts to denaturate at 76 °C, while WZA2-L1-TteUvrD protein denaturation starts at 61.1°C.
A
B
Figure 9. Fluorescence thermal shift assay for proteins stability characterization. A - simulated dependence of the WZA2-L1-TteUvrD melting temperature; B - simulated dependence of the WZB1-L1-BstPol melting temperature.
According to obtained enzyme stability data, kinetic experiments were performed. WZA2-L1-TteUvrD activity was measured based on SYBR GreenI fluorescent dye, which emits fluorescence upon binding with double-stranded DNA. Otherwise, if helicase separates dsDNA, fluorescence then declines proportionally7. As shown in Fig. 10A and Fig. 10B the bigger amount of WZA2-L1-TteUvrD protein is in the assay, the more dsDNA is unwinded.
A
B
Figure 10. Time dependent analysis of the helicase activity assay. Three different concentrations were used: 4 nM, 44 nM, 1000 nM. A - raw data of helicase activity assay, where fluorescence intensitivity decreases depending on helicase concentration; B - normalised data of helicase activity assay, which shows the percentage of substrate unwound depending on the helicase concentration.
WZB1-L1-BstPol activity (Fig. 11A and Fig. 11B) was also measured by observing its fluorescence depending on time. The bigger the polymerase concentration is in the assay, the more amplified fragments are being generated. Linear dependence of polymerase activity on its substrate in solution was also determined by using fluorescence measurements.
A
B
Figure 11. Time dependent analysis of the BstPol activity assay. A - generation of dsDNA depending on BstPol amount in the assay. B - polymerase activity assay depending on the substrate concentration.
Based on these enzymes' activity assays we determined that the synthesis of active helimerase proteins was successful. However, after a lot of attempts we were unable to fuse these proteins via coiled-coil amino acid structures in vivo and in vitro. We hypothesized that newly formed affinity tags, as such as tertiary structures, could influence these proteins' interaction with each other, so in order to tackle this problem, new affinity tags and linkers should be tested. Also, with the aim to co-express these proteins in vivo, they could be cloned into other compatible plasmids.
Goal. To create genetically engineered bacteria that are able to sense pathogenic bacteria biofilm secreted AI-2 and express a sufficient amount of exolysin and toxin.
Results. The inducible kill-switch is created and exolysin depolymerase activity was determined. The AI-2 inducible promoters work as expected.
Future directions. To create a more precise AI-2-sensing circuit and improve lysis protein function.
The main goals were to construct two genetic circuits that are capable of expressing a sufficient amount of depolymerase and initiate cell-lysis. The genetic circuit is based on a quorum sensing Type II system that uses autoinducer-2 for bacterial interspecies communication. The treatment circuits have an exolysin gene accompanied by E. coli lysing proteins: endolysin lysECD7 or mazEF system.
Before starting to construct the whole treatment genetic circuit, we needed to determine the strength of autoinducer-2 inducible promoters. To do that it was decided to compare lsrACDBFG and its mutants, EP01r, EP14r, with Anderson’s promoters that is a conventional part collection. The literature shows that these AI-2 inducible promoters are quite weak. Before narrowing the window of possible promoters‘ strength values, there was a need to get AI-2 as a 4,5-dihydroxy-2,3-pentanedione (DPD). Keeping in mind that AI-2 is costly and there are not well-described parts that are the base of AI-2 synthesis, it was decided to synthesize AI-2 in vitro10,11. As described in Engineering for the production of AI-2 there is a need for luxS and pfs proteins that are key enzymes for converting S-adenosylhomocysteine (SAH) into AI-2.
The protein-coding genes pfs (693bp) and luxS (510bp) cloned into pET28a(+) vector (restriction sites: NcoI and XhoI). The plasmid was transformed in E. coli BL21(DE3) strain. After the induction with IPTG, the protein purification followed. After performing SDS-PAGE (Fig.1, Fig.2) pfs and luxS proteins were successfully purified and soluble in native conditions. The purified proteins were used for the following experiments.
Figure 1. Purification of pfs enzyme in BL21(DE3) E. coli strain. L- PageRuler Plus Prestained Protein Ladder (Thermo Fisher Scientific), 1 - BL21(DE3) pET28a(+)-pfs biomass sample before induction, 2 - BL21(DE3) pET28a(+)-pfs supernatant (soluble) fraction after ultrasound lysis, 3 - purified, concentrated pfs protein(25.5kDa).
Figure 2. LuxS purification experiment in BL21(DE3) strain in pET28a(+) plasmid. 1 – BL21(DE3) pET28a(+)-luxS biomass sample before induction, 2 - BL21(DE3) pET28a(+)-luxS biomass sample after induction, 3 - Supernatant (soluble) fraction after ultrasound lysis, 4 - Precipitant (insoluble) fraction after ultrasound lysis, 5 - purified, concentrated protein (20.6kDa), L- PageRuler Plus Prestained Protein Ladder (Thermo Fisher Scientific).
The purified proteins were used for in vitro reaction of AI-2 synthesis (Fig.3). This reaction product and its concentration was identified with Ellman reagent (5,5'-dithiobis-(2-nitrobenzoic acid). This reagent reacts with compounds that have a thiol group. The reaction product 2-nitro-5-thiobenzoate (TNB−) ionizes to the TNB2− that gives a yellow color to the solution. In that way, the concentration of TNB2−(ion amount is equal to the compound’s amount that has thiol groups) can be measured via measuring solution's absorption at 412nm and calculating the concentration of DPD.
Figure 3. The chemical reaction catalyzed by pfs and luxS from a precursor S-adenosylhomocysteine (SAH) to AI-2 as a linearised form DPD.
The following step after successfully producing AI-2, was to test whether the genetic circuit J23XXX-sfGFP reacts to AI-2, and if so, at what concentrations the signal is increased. Before determining the most suitable promoter for treatment genetic circuit, a few promoters from the Anderson promoter collection compared with AI-2 inducible promoters: lsrACDBFG, EP01r, EP14r. The measurements that followed are described here. After a few trials, the genetic circuit that has a weak Anderson promoter (J23117) was chosen. To add more, even for a more efficient system it could have an even weaker promoter but due to the lack of a DNA distribution kit, there was no possibility to get weaker Anderson promoters. The fluorescence intensity and OD600 were measured and the ratio was calculated. All bar plots are indicating a ratio at 6h hours of bacterial growth (exponential growth phase).
Figure 4. EP01r promoter strength measurement inducing with AI-2. From left to right: ‘+’- a positive control (J23117-sfGFP), without AI-2, 12μM, 18μM, 24μM of AI-2.
Figure 5. lsrACDBFG promoter strength measurement inducing with AI-2 after 6h of bacteria growth. From left to right: ‘+’- a positive control (J23117-sfGFP), without AI-2, 12μM, 18μM, 24μM of AI-2.
The results did not reiterate as expected. Only AI-2 inducible promoter lsrACDBFG-sfGFP signal showed a correlation with increasing AI-2 concentration(Fig.5 and Fig. 6). The EP01r is expected to be a stronger promoter than lsrACDBFG4. To add more, all three AI-2 inducible promoters are leaky: when there is no AI-2 added there can be seen an emission of enhanced sfGFP. There is little known about these promoters. Thus, the conclusions are not valid enough. This might be affected by changing the plate reader devices, non-optimized sequences, or unprocessed experiment conditions. However, after the last experiments construct lsrACDBFG-mazF-J23117-sfGFP showed positive results: there can be seen a positive toxin mazF activity. The increase of AI-2 concentration leads to cell-lysis of E. coli.
Figure 6. lsrACDFBG promoter strength measurement inducing by AI-2 changes over time. The concentrations varied from 0μM to 24μM.
Figure 7. lsrACDBFG-mazF-J23117-sfGFP dependency on AI-2 concentration over time.
However, counting the last days left until wiki freeze, the genetic circuit lsrACDBFG-mazF-J23117-sfGFP showed expected results. The mentioned genetic circuit activity was dependent on AI-2 concentration (Fig.7). The increase of AI-2 lead to cell lysis due to increased lsrACDBFG activity and mazF expression. Fig. 8 illustrates the difference between positive control or colonies without the induction of AI-2 between those colonies that were induced.
Figure 8. lsrACDBFG-mazF-J23117-sfGFP dependency on AI-2 concentration.
To verify that our proteins had exolysin activity we had to do bioinformatic analysis. By comparing the sequences of the genes and their gene products, we can predict that they are tail fiber proteins. Also, by using the Basic Local Alignment Search Tool (BLASTx) we have found that these proteins show high similarities(>89%) with K. pneumoniae phage K64-1 tail spike/ structural proteins which have been proven to be responsible for depolymerization of the bacteria polysaccharides13 (Table 1). Also, gp533 (BBa_K3416033) is homologous (85,58%) to the gene which will result in a protein with pectate lyase enzymatic activity (Table 1). After exolysin sequence analysis, we can deduct that our proteins have pectate lyase activity.
Table 1. BLAST comparative analysis of Klebsiella phage RAK-2 and K64-1 proteins.
| RAK-2 protein / Accession | K64-1 protein / Accession | E value | Percentage identity |
|---|---|---|---|
| gp529 YP_007007684.1 | Putative tail fiber protein YP_009153199.1 | 0.0 | 99.49% |
| gp531 YP_007007686.1 | Putative tail fiber protein YP_009153201.1 | 3e-137 | 91.94% |
| gp533 YP_007007688.1 | Putative structural protein YP_009153203.1 | 0.0 | 89.96% |
| gp533 YP_007007688.1 | S2-6 gene for pectate lyase LC121105.1 | 0.0 | 85.83% |
Pectate lyase is responsible for eliminating cleavage of pectate, yielding oligosaccharides with 4-deoxy-α-D-mann-4-enuronosyl at their non-reducing ends (Fig. 9).
Figure 9. Pectate lyase catalyzed reaction
To test exolysins' activity, we tried to induce and purify three different exolysins (BBa_K3416029), (BBa_K3416031), (BBa_K3416033). Plasmids with the cloned exolysins were kindly provided by prof. Rolandas Meškys. Plasmid pET28b(+)-gp529 was transformed into Rosetta (DE3) strain and induced with 0.5mM IPTG for 19 hours in 16°C in 200mL LB. Biomass was resuspended into 50mM Tris-HCl pH=8 and ultrasound lysed until the solution became clear. His-tagged protein was purified using Ni-NTA. Dialysed and concentrated. Yielding a 1.2mg of the protein from 200mL of LB medium. But the protein was not in its active form. Thus, more optimization is required. Plasmid pET16b(+)-gp531 was transformed into Rosetta (DE3) strain and induced with 0.5mM IPTG for 17 hours in 16°C in 200mL LB. Biomass was resuspended into 50mM Tris-HCl pH=8 and ultrasound lysed until the solution became clear. His-tagged protein was purified using Ni-NTA. Dialysed and concentrated Yielding 0.8mg from 200mL of LB medium. Synthesis should be optimized if a larger yield of the protein is desired but the protein amount was sufficient to see a visible activity on the spot test. Plasmid pET16b(+)-gp533 was transformed into Rosetta (DE3) strain and induced with 0.5mM IPTG for 21 hours in 17°C in 200mL LB. Biomass was resuspended into 50mM Tris-HCl pH=8 and ultrasound lysed until the solution became clear. His-tagged protein was purified using Ni-NTA. Dialysed and concentrated. (Fig. 10) Yielding 0.78mg from 200mL of LB medium. Synthesis should be optimized if a larger yield of the protein is desired but the protein amount was sufficient to see a visible activity on the spot test.
Figure 10. SDS-PAGE electrophoresis results after gp529, gp531, gp533 purification. L - PageRulerTM Prestained Protein Ladder, #SM0671 (Fermentas), 1 – gp529 biomass sample before induction, 2 – gp529 biomass sample after induction, 3 -purified and highly concentrated gp529 (62.5 kDa), 4 - gp531 biomass sample before induction, 5 – gp531 biomass sample after induction, 6 - gp531 purified protein (97.8 kDa), 7 - gp533 biomass sample before induction, 8 - gp533 biomass sample after induction, gp533 purified protein (82.2 kDa).
After purification, we tested exolysin activity using the spot test on Klebsiella sp. KV-3 strain. First, we performed an experiment to determine a minimal amount of protein needed to form a lysis halo (Fig.3). 5μL of 4μM initial (101) starting concentration of all exolysins were used. Dilutions were 101, 10-1, 10-2, 10-3, 10-4, 10-5. After spot test analysis it was seen the exolysin gp529 did not show any depolymerase activity towards this strain, while gp531 had the most visible activity. After dilution experiments, the smallest measured exolysin concentration, which can induce cell lysis is 10-2 – 10-3 of initial concentration. However, even if this part works, after sequencing we saw that this gene sequence is not compatible with iGEM standard construction. Due to this, we decided not to use it in our genetic circuit. However, gp533 showed minimal but detectable depolymerase activity so we decided to construct it under AI-2 induced promoter. For the spot test positive control we have chosen RAK-2 phage, which was kindly provided by doc. Algirdas Noreika. Phage dilution was 101 10-2, 10-4, 10-6, 10-8, 10-10. As the negative control, we used 50 mM Tris– HCl pH=8.
Figure 11. A) Spot test with serial dilutions of gp529, gp531, gp533 exolysins. From top to bottom the proteins were gp529, gp531, gp533, RAK-2(positive control), blank(negative control). Tris- HCl was used as a negative control. From left to right the protein dilutions were 101, 10-1, 10-2, 10-3, 10-4, 10-5 and phage dilutions were 101 10-2, 10-4, 10-6, 10-8, 10-10. B) Spot test with gp529, gp531, gp533 exolysins (24μmol) incubated at 42oC, 60oC, 65oC, 70oC . From top to bottom the proteins were gp529, gp531, gp533, RAK-2(positive control), blank(negative control). RAK-2 phage (1.2 * 1010 PFU/mL) was used as a positive control. Tris- HCl was used as a negative control.
Goal - To synthesize and purify immunogenic proteins GldJ and VHSV glycoprotein G and examine how alginate beads withstand pressure and interact with digestive system in vitro.
Results - Both GldJ and VHSV glycoprotein G were successfully cloned into appropriate protein expression vectors. However, no immunogenic protein synthesis was achieved. Physical and chemical alginate bead tests provided valuable insight into further developments of orally administered recombinant protein vaccines for fish immunization.
Future directions - To purify both recombinant immunogenic proteins as well as to test the beads with immunogenic proteins in vivo, therefore proving their potential to be used as vaccines.
GldJ is an immune response inducing protein. We decided to synthesize it using E. coli bacteria strains. Thus, our team successfully cloned gldJ gene (1731 bp) into pET28a(+) vector. This was confirmed by Sanger sequencing. However, after induction with 1mM IPTG at 16°C for 18 hours in 50mL LB medium. After SDS-page analysis (Fig. 1), we found out that two proteins were expressed, but their sizes indicated that it was not GldJ, which should have been 66 kDa.
Figure 1. SDS-PAGE electrophoresis results after GldJ induction in different E. coli strains. L- PageRuler Plus Prestained Protein Ladder (#26620), 1BL – E. coli BL21(DE3) biomass sample before induction, 1RO – E. coli Rosetta(DE3) biomass sample before induction, 1AE - E. coli ArcticExpress(DE3) biomass sample before induction, 2BL – E. coli BL21(DE3) biomass sample after induction, 2RO - E. coli Rosetta(DE3) biomass sample after induction, 2AE - E. coli ArcticExpress(DE3) biomass sample after induction, 3BL - E. coli BL21(DE3) supernatant sample after ultrasound lysis, 3RO - E. coli Rosetta(DE3) supernatant sample after ultrasound lysis, 3AE - E. coli ArcticExpress supernatant sample after ultrasound lysis.
The protein of interest was also not detected by Western blot analysis with Anti-His antibodies (Fig. 2).
Figure 2. Western blot results after GldJ induction in different E. coli strains. L- PageRuler Plus Prestained Protein Ladder (#26620), 1 – Control protein, 2 – E. coli ArcticExpress supernatant sample after ultrasound lysis, 3 - E. coli Rosetta(DE3) supernatant sample after ultrasound lysis, 4 - E. coli BL21(DE3) supernatant sample after ultrasound lysis, 5 - E. coli ArcticExpress(DE3) biomass sample after induction, 6 - E. coli Rosetta(DE3) biomass sample after induction, 7 - E. coli BL21(DE3) biomass sample after induction.
After using trehalose to enhance the protein solubility12, we did not see any difference in the size of the proteins after SDS-PAGE electrophoresis (Fig. 3). However, Western blot analysis confirmed that the amount of soluble recombinant protein was significantly higher after sample treatment with trehalose (Fig. 4).
Figure 3. SDS-PAGE electrophoresis results of GldJ with and without trehalose from ArcticExpress E. coli strain. L- PageRuler Plus Prestained Protein Ladder (#26620), 1 – supernatant with a 0.7M trehalose after Ni-NTA purification, 2 – Precipitant fraction without trehalose, 3 - Precipitant fraction with trehalose, 4 - Supernatant fraction without trehalose, 5 - Supernatant fraction with trehalose, 6 - E. coli ArcticExpress biomass sample after induction, 7 - E. coli ArcticExpress biomass sample before induction.
Figure 4. SDS-PAGE electrophoresis results of GldJ with and without trehalose purified from ArcticExpress E. coli strain. L- PageRuler Plus Prestained Protein Ladder (#26620), 1 – First elution fraction Ni-NTA purification with trehalose in resuspension buffer, 2 – second elution fraction Ni-NTA purification with trehalose in resuspension buffer, 3 - precipitant fraction after ultrasound lysis without trehalose, 4 - precipitant fraction after ultrasound lysis with trehalose, 5 - supernatant fraction after ultrasound lysis without trehalose, 6 - supernatant fraction after ultrasound lysis with trehalose, 7 - E. coli ArcticExpress(DE3) biomass sample after induction.
VHSV glycoprotein G gene (1545 bp) with a 6xHis tag on the N-terminus of the sequence was cloned into a pfX7 vector. Sanger sequencing confirmed that the procedure was successful. After transforming the plasmid into S. cerevisiae AH22-214 strain and inducing the cells with 25mL 12% galactose and growing at 30°C for 24 hours with 25 mL 2xYEP medium containing 0.1% formaldehyde, SDS-PAGE analysis was performed. No trace of VHSV glycoprotein G (57kDa) was found (Fig. 5a). Only an unknown protein around half the desired size was purified. After performing identical procedures with AH22-214Δpep S. cerevisiae strain (Fig. 5b), similar results were yielded, with no protein of interest and a purified unknown protein. Western blot analysis showed no substantial results.
Figure 5. SDS-PAGE electrophoresis results after glycoprotein G synthesis induction in (a) S. cerevisiae AH22-214 strain and (b) AH22-214Δpep strain. L - PageRuler Plus Prestained Protein Ladder (#26620), b- protein sample before induction, a - protein sample after induction, s - supernatant sample, p - precipitate sample, ff - flow through, f1-5 - chromatography elution fractions.
In order to test whether our immunogenic protein would reach the midgut of the fish undigested, we designed an experiment where different conditions were applied onto alginate beads containing GFP. We tried to imitate decomposition of alginate beads by using EDTA. Both of them are chelators which interact and bind to Ca2+ ions therefore disrupt the bead structure (Table 1). All tested beads had a uniform diameter of 5mm and final concentration of GFP in each bead was 0.4mg/mL with 2% alginate used. 1mL of 1mg/mL concentration of either pepsin/ trypsin/0.1M EDTA was used on 2 alginate beads in accordance with experiment conditions provided in the table.
Table 1. Alginate beads with GFP affected by digestive enzymes and chelating substances. 1 - alginate beads with pepsin pH=3, 2 - alginate beads without pepsin pH=3, alginate beads with pepsin pH=4, 4 - alginate beads without pepsin pH=4, 5- alginate beads with trypsin pH=9, 6- alginate beads without trypsin pH=9, 7- alginate beads with EDTA.
We found out that the buffer of pH 3 affected GFP inside alginate beads as the protein's fluorescence weakened after 2h. EDTA also affected bead structure and ruptured it over time. There were no visible changes in pH 9 with and without trypsin and in pH 4 with and without pepsin. This means that beads were not affected by these conditions, that would be affecting the bead while it would travel through the fish gut.
When our team found out that E. coli does not have an alginate lyase gene while Klebsiella pneumonia KV-3 does, we decided to make an experiment where we incubated beads with bacteria in order to test how long it would take for bacteria to digest the beads13. We tested Klebsiella pneumonia KV-3 and E. coli strain BL21(DE3) difference in alginate degradation and beads inside Klebsiella pneumonia KV-3 were completely disintegrated whereas E. coli bacteria were not able to decompose alginate beads at all (Table 2).
Table 2. Alginate beads with GFP incubated with E. coli and Klebsiella pneumonia KV-3 in LB medium from left to right - without beads, with beads that do not contain protein and beads with GFP. 1 - E. coli BL21(DE3) before adding bacteria to medium, 2 - E. coli BL21(DE3) 3 days after adding bacteria to medium, 3 - Klebsiella pneumonia KV-3 before adding bacteria to medium, 4 - 3 days after adding Klebsiella pneumonia KV-3 to medium.
Alginate beads with GFP and beads without a protein were compressed using a universal testing machine TIRA test 2300. By applying force over time at a rate of 10mm/min onto the bead, it was measured at what point alginate starts to rupture (Fig. 6). The parameters at the point of breakage were recalculated according to Maurice et. al.14. The stress and strain at failure values were below the recommended values of a 0.13-0.32MPa (Table 3). Which means that the produced beads would not be able to withstand physical challenges of the fish digestive tract. It is important to note that a significant difference in rigidity of the beads was observed between control beads and the beads containing a protein. Which means that the stiffness depends on protein concentration and should be considered when producing vaccines for in vivo experiments.
Table 3. Stress and strain at failure of control alginate beads without the protein and beads with GFP. The results are averaged from twenty measured beads.
| Bead type | Stress at failure (MPa) | Strain at failure (-) |
|---|---|---|
| With GFP | 0.0351 ±0.0026 | 0.5522 ±0.0338 |
| Empty control | 0.0273 ±0.0084 | 0.5784 ±0.0354 |
Figure 6. Example of force applied on the bead with GFP at a rate of 10mm/min over time. The yellow line indicates the rupture point of the bead.
Effective orally administered vaccines against columnariosis and viral hemorrhagic septicemia diseases could be developed if our current research would be further implemented and improved. This could be achieved by optimising protein purification and testing alginate beads more thoroughly. Also, other types of gliding motility lipoproteins could be used, since most of them have immunogenic properties. For VHSV glycoprotein G, it would be beneficial to try using Pichia pastoris and algae for protein expression, as this could help to solve the glycosylation problem. Finally, it is crucial to perform ELISA assay and testing the beads with immunogenic proteins in vivo, to prove their potential to be used as vaccines.
References
- Strepparava, N., Wahli, T., Segner, H. et al. Detection and quantification of Flavobacterium psychrophilum in water and fish tissue samples by quantitative real time PCR. BMC Microbiol 14, 105 (2014)
- Kolm, C., Martzy, R., Führer, M. et al. Detection of a microbial source tracking marker by isothermal helicase-dependent amplification and a nucleic acid lateral-flow strip test. Sci Rep 9, 393 (2019).
- Kosack, C. S., Page, A. L. & Klatser, P. R. A guide to aid the selection of diagnostic tests. Bulletin of the World Health Organization 95, 639–645 (2017).
- Motré, A., Li, Y. & Kong, H. Enhancing helicase-dependent amplification by fusing the helicase with the DNA polymerase. Gene 420, 17–22 (2008).
- Matulis, D., Kranz, J. K., Salemme, F. R. & Todd, M. J. Thermodynamic Stability of Carbonic Anhydrase: Measurements of Binding Affinity and Stoichiometry Using ThermoFluor. (2005) doi:10.1021/bi048135v.
- Cimmperman, P. et al. A quantitative model of thermal stabilization and destabilization of proteins by ligands. Biophysical Journal 95, 3222–3231 (2008).
- Siddiqui, S., Khan, I., Zarina, S. & Ali, S. Use of the SYBR Green dye for measuring helicase activity. Enzyme and Microbial Technology 52, 196–198 (2013).
- Wattanavanitchakorn, S., Prakitchaiwattana, C. & Thamyongkit, P. Rapid and simple colorimetric method for the quantification of AI-2 produced from Salmonella Typhimurium. Journal of Microbiological Methods 99, 15–21 (2014).
- Ascenso, O. S. et al. An efficient synthesis of the precursor of AI-2, the signalling molecule for inter-species quorum sensing. Bioorganic & Medicinal Chemistry 19, 1236–1241 (2011).
- Ellman, George L. "Tissue sulfhydryl groups." Archives of biochemistry and biophysics 82.1 (1959): 70-77.
- Hauk, P. et al. Insightful directed evolution of Escherichia coli quorum sensing promoter region of the lsrACDBFG operon: a tool for synthetic biology systems and protein expression. Nucleic Acids Res gkw981 (2016) doi:10.1093/nar/gkw981.
- Leibly, D. J. et al. Stabilizing Additives Added during Cell Lysis Aid in the Solubilization of Recombinant Proteins. PLoS ONE 7, e52482 (2012).
- Tavafi, H., Abdi- Ali, A. A., Ghadam, P. & Gharavi, S. Screening of Alginate Lyase-Producing Bacteria and Optimization of Media Compositions for Extracellular Alginate Lyase Production. Iran Biomed J 21, 48–56 (2017).
- Maurice, S., Nussinovitch, A., Jaffe, N., Shoseyov, O. & Gertler, A. Oral immunization of Carassius auratus with modified recombinant A-layer proteins entrapped in alginate beads. Vaccine 23, 450–459 (2004).
contact us
follow us
