Latest revision as of 00:08, 19 December 2020

Loading...

Design

OVERVIEW

On our journey of helping the aquatic life, we built three pillars on which we founded project FlavoFlow. The first pillar is detection - we designed and produced a simple-to-use pathogenic bacteria detection kit, based on HDA and LFA methodology, which will be of immense help to farmers in quickly and accurately identifying an exact pathogen decimating their aquafarms. The second pillar is a novel bacterial infection treatment system, which uses engineered bacteria to provide a highly specific lysis protein action against the target pathogen without being damaging to the environment. And lastly, the third pillar is a contemporary alginate-contained vaccination solution developed to protect against bacterial and viral fish infections, while also offering precise delivery along with low production, transport and storage costs.

SEE OUR DESIGN FLOW

DETECTION

Bioinformatic Analysis

Helicase-Dependent Amplification

Helimerase

Lateral Flow Assay

TREATMENT

Endolysin & Exolysin System

Toxin & Antitoxin System

PREVENTION

Subunit Vaccines

DETECTION

Detection

Overview

During the past few years, recirculatory aquaculture systems (RAS) became a widely used system for cold-water fish production. With the benefits of these systems, infections also have taken its place. One of the broadest ranges of any fish bacterial pathogens constitutes Flavobacterium columnare and Flavobacterium psychrophilum bacteria, which causes columnariosis and cold-water disease or rainbow trout fry syndrome, respectively. The biggest issue with these diseases is high mortality rates, which often reaches 70 % of the infected fish population only in 24-72 hours1. Due to this rapid spread of infections, there is a massive demand for the point-of-care diagnostic systems, which could identify an exact species of Flavobacterium genus.

Our Flavo detection design is made up of three main steps:

A bioinformatic analysis of the marker gene sequences which does not match between Flavobacterium species. Creation of LFA ssDNA probes and HDA primers.
Helicase-dependent asymmetric DNA amplification (HDA) of the chosen marker gene fragments.
Lateral flow assay (LFA) membrane test based on nucleic acid hybridization that just in a few minutes identifies an exact pathogen.

Bioinformatic Analysis

Since we wanted to differentiate between Flavobacterium species, instead of antibody-antigen interaction, our detection test is based on nucleic acid hybridization. We found out that for identification purposes, nucleic acids are a more reliable and specific source than antibodies2.

The first step in developing a lateral flow assay test based on nucleic acid hybridization is choosing marker genes, which allows us to identify an exact bacteria species. According to our literature research, 16S rRNA gene is a suitable candidate for this purpose because it is present in almost all bacteria and its function did not change over time3. Also, we found that single copy rpoC gene coding β' DNA-dependent RNA polymerase can be used as a marker for F. psychrophilum species4. As well as cslA gene coding chondroitin AC lyase for F. columnare species5.

After choosing marker sequences to identify specific Flavobacteria, we focused on lateral flow assay test development. To do this, we created three single-stranded DNA (ssDNA) probes: detection and capture probes that would hybridize to the amplified fragment of the marker gene as well as the control probe.

The detection probe is used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by the gold nanoparticle. If the probe sequence is unmodified then after conjugation with the gold nanoparticle it can lose its molecular recognition function6. For this reason, a poly-A sequence followed by the thiol group (ThioMC6-D, IDT) is added to the 5' end and the rest of the sequence is left free for hybridization.

The capture probe also has a 3' modification of poly-A to make sure that the probe sequence itself is available for hybridization followed by biotin moiety (bio, IDT). Biotin modification is needed so that the probe could be immobilized on the test line of the lateral flow assay test strip via biotin-streptavidin non-covalent interaction. Control probe has a 5' biotin moiety (biosg, IDT) for the same reason as well.

In our case, the detection and capture probes were created to be complementary to the negative strand of the gene (table 1). Control probe is complementary only to the detection probe.

After creating ssDNA probes for lateral flow assay, primers for HDA meant to amplify fragments with probe hybridization sites were created using the IDT PrimerQuest tool and following manufacturers recommended parameters: GC % 30 - 60%, Tm 60°C - 80°C, size 20 - 35 bp.

Table 1. Detection and capture probe placement on the DNA strand. Underlined sequence part marks HDA primers placement.

Species	Detection probe & Capture probe
F. columnare 16S rRNA gene	CAGGGGGATAGCCCAGAGAAATTTGGATTAATACCCCATAGTATTTTCAGATGGCCTCATTTGATTATTAAAGTTCCAACGGTACAAGATGAGCATGCGTCCCATTAGCTAGTTGGTGTGGT
F. columnare cslA gene	AATGACTTCAACTAGAACAGTAGGTGCTGAAGCAGGTAATAATTCAGGGAATTATAACTATTATGCAGGGGCAGGAGTGAATTACACAATTCATA
F. psychrophilum 16S rRNA gene	GGATAGCCCAGAGAAATTTGGATTAATACCTCATAGTATAGTGAGTTGGCATCAACACACTATTAAAGTCACAACGGTAAAAGATGAGCATGCGTCCCATTAGCTAGTTG
F. psychrophilum rpoC gene	ACGGGTATTCTTCTTGCTACAAATAATATTCCTTACGGTTCAAGTATTTATG TAAATGACGCTCAAGTTGTAGAAAAAGGAGATGTTATTTGTAAATGGGATCC

Helicase-dependent amplification

With the aim to create a rapid, specific and cost-effective point-of-care detection system, at first, we needed to find the most suitable isothermal DNA amplification method. This method should be usable for farmers who have no scientific background. This factor pinpoints a huge need to be able to perform these isothermal reactions with as minimal pipetting steps as possible by means of avoiding errors and false-positive results. Although, amplification of marker sequences should be done in constant temperature by the needs of cheap and fully-portable equipment.

By leading these main requirements, we have distinguished some isothermal amplification methods such as helicase-dependent amplification (HDA), loop-mediated isothermal amplification (LAMP), strand-displacement amplification (SDA) and rolling circle amplification (RCA)7.

However, LAMP, SDA or RCA amplification methods have their own limitations such as complicated reaction schemes or multiplex sets of primers. Also, it should be mentioned that each of these methods are incapable of amplifying DNA targets of sufficient length required for lateral flow assay test8.

After further analysis, we found out that in order to fulfil these goals, helicase-dependent amplification would be a perfect solution. This method allows us to make our detection test as specific as possible by using an exact length of target sequences. Thus, it provides a simple reaction scheme and enables the generation of single-stranded DNA fragments, which are essential for lateral flow assay test development9.

Helimerase

However, regarding the WHO guidelines for point-of-care testing, our detection tool should not only be sensitive, specific and user-friendly but also it should be affordable for target customers10. Keeping in mind that HDA amplification, performed using a commercial kit, is still too expensive, we have decided to search for new alternatives to reduce the cost of the test as much as possible.

Our solution to this problem - helimerase. This protein complex contains two enzymes - Thermoanaerobacter tengcongensis UvrD helicase (TteUvrD) and Bacillus stearothermophilus DNA polymerase I large fragment (BstPol). TteUvrD is fused with one part of coiled-coil structure WinZip-A2 (WZA2) via linker L1 and possesses a maltose-binding protein (MBP) and 10xHis Tag in the N terminal end. BstPol is fused with the second coiled-coil part WinZip-B1 (WZB1) through linker L1 and possesses StrepII tag in the N terminal end11. It was presumed that this non-covalent fusion strategy through coiled-coil structures should improve HDA reaction by letting to amplify longer DNA fragments as well as it allows to perform amplification reaction without using additional proteins such as MutL or others SSB proteins, which are used in such kind of reactions11,12.

Lateral Flow Assay

However, a method to visualize HDA amplification results is still needed because in remote locations methods such as electrophoresis are not feasible. To solve this problem, we decided to choose lateral flow assay (LFA). The use of the test is very intuitive, requiring no prior training and can be used for isothermal amplification results visualisation. Also, this LFA test is cost-effective and portable. Because of this, it is commonly used in remote locations where access to scientific laboratories is limited. For these reasons, we have decided that the best strategy for rapid flavobacterium-caused infection detection tool development is the combination of HDA and LFA methods.

TREATMENT

Treatment

After detection of an exact Flavobacterium species, farmers need to start an exact treatment process as soon as possible. Currently, fish infected with flavobacterial diseases are treated with different types of antibiotics28. Scientific data shows35 that the most abundant antibiotic used for salmon cultivation was quinolone, whose consumption (by mass) in 2007 reached 821,997 tonnes. And that is only in Norway! Other commonly used antibiotics in farms are oxolinic acid and florfenicol, whose consumption reached 681 kg in 2008 and 166 kg in 2010 respectively. This enormous usage of a broad range of antibiotics forces the evolving of antibiotic-resistant bacterial fish pathogens. It is quite evident that these numbers raise huge concerns and questions on how we can reduce the usage of antibiotics?

Scientific data already shows that some F. psychrophilum isolates already have reduced susceptibility to quinolones, oxolinic acid, and enrofloxacin16. To reduce the amount of antibiotics used in aquaculture farms, our second goal is the development of two exogenous fish infection treatment systems, which are based on quorum sensing mechanisms. The treatment section fulfils our project main idea - Detection and offers an alternative way of fighting with pathogenic infections.

Flavobacterial diseases occur when Flavobacterium forms a biofilm on fish fins or gills30. Our target bacteria - Flavobacterium uses signalling molecules for cell-cell communication. Quorum sensing is a bacterial communication process that leads to the regulation of genes and response to changes17–19. The quorum sensing has two distinguished systems - AHL and AI-2 for Gram-negative bacteria for now19–21. We used the circumstances to our advantage: build two genetic circuits that are enhanced by quorum sensing signalling molecules. Both synthetic biological systems are for exolysin synthesis, the difference is how transporter cell lyses itself. Thus, we are introducing three different strength AI-2 inducible promoters: a native lsrACDBFG (K3416000) and two mutated ones EP01r (K3416001) and EP14r (K3416014).

Choose treatment system

Endolysin & Exolysin System

Toxin & Antitoxin System

Endolysin & Exolysin System

Toxin & Antitoxin System

Our priority plan was to use flavobacterial phage lysins and to test it on a specific bacteria species. But we were unable to acquire neither a phage nor a lysin nor its gene sequence because there is so little research and discoveries made on aquatic phage exolysins31.

Luckily, we found that in the Life Sciences Center, Vilnius, Lithuania experiments are being conducted on Klebsiella KV-3 phage’s RAK-2 exolysins. Exolysin gene and Klebsiella pneumoniae bacteria were kindly provided for us to use by R.Meškys.

You may ask what is similar between Klebsiella pneumoniae and Flavobacterium columnare, Flavobacterium branchiophilum, or Flavobacterium psychrophilum.

First of all, Klebsiella pneumoniae is gram-negative as well as other many pathogenic fish diseases causing bacteria including Flavobacterium species.

Secondly, to form a biofilm K. pneumoniae uses the same quorum-sensing molecule – autoinducer-226

Thirdly, it has a similar structure to Flavobacterium, which uses a bacterial capsule as its virulence factor.

Lastly, like many other pathogenic bacteria both Flavobacterium species and K.pneumoniae can form biofilms27.

PREVENTION

Prevention

Usually, in order to prevent fish infections, vaccines are injected intraperitoneally. Because of manual handling, which is unavoidable in such a type of vaccination, fish experience a lot of stress and it paradoxically weakens their immune system52. With the aim to avoid such consequences, we have set the third goal - to create a prevention system based on subunit vaccines against bacterial and viral fish infections.

Subunit vaccines

References

Loch, T. P. & Faisal, M. Emerging flavobacterial infections in fish: A review. Journal of Advanced Research vol. 6 283–300 (2015).
Chen, A. & Yang, S. Replacing antibodies with aptamers in lateral flow immunoassay. Biosensors and Bioelectronics vol. 71 230–242 (2015).
Janda, J. M. & Abbott, S. L. 16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: Pluses, perils, and pitfalls. Journal of Clinical Microbiology vol. 45 2761–2764 (2007).
Strepparava, N., Wahli, T., Segner, H. & Petrini, O. Detection and quantification of Flavobacterium psychrophilum in water and fish tissue samples by quantitative real time PCR. http://www.biomedcentral.com/1471-2180/14/105 (2014).
Mabrok, M. et al. Development of a species-specific polymerase chain reaction for highly sensitive detection of Flavobacterium columnare targeting chondroitin AC lyase gene. Aquaculture 521, (2020).
Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Analytical Methods vol. 9 2633–2643 (2017).
Zaghloul, H. & El-Shahat, M. Recombinase polymerase amplification as a promising tool in hepatitis C virus diagnosis. World Journal of Hepatology vol. 6 916–922 (2014).
Vincent, M., Xu, Y. & Kong, H. Helicase-dependent isothermal DNA amplification. EMBO Reports 5, 795–800 (2004).
Kolm, C. et al. Detection of a microbial source tracking marker by isothermal helicase-dependent amplification and a nucleic acid lateral-flow strip test. Scientific Reports 9, (2019).
Kosack, C. S., Page, A. L. & Klatser, P. R. A guide to aid the selection of diagnostic tests. Bulletin of the World Health Organization 95, 639–645 (2017).
Motré, A., Li, Y. & Kong, H. Enhancing helicase-dependent amplification by fusing the helicase with the DNA polymerase. Gene 420, 17–22 (2008).
Jeong, Y. J., Park, K. & Kim, D. E. Isothermal DNA amplification in vitro: the helicase-dependent amplification system. Cellular and molecular life sciences : CMLS vol. 66 3325–3336 (2009).
Perez, D., Sandra, P., Giannina, B. and Caterina, R. Nucleic-Acid Lateral Flow Assay Optimization with Different Gold Nanoparticle Size for Detection of Pathogen after PCR, Using L. Monocytogenes as Model. Acta Scientific Microbiology, 1(10), 17-24 (2018).
Liu, B. and Liu, J., Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Analytical Methods, 9(18), 2633-2643 (2017).
Zhang, X., Servos, M. and Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. Journal of the American Chemical Society, 134(17), 7266-7269 (2012).
Saticioglu, I. B. Antimicrobial resistance and resistance genes in Flavobacterium psychrophilum isolates from Turkey. 8 (2019).
Xavier, K. B. et al. Phosphorylation and Processing of the Quorum-Sensing Molecule Autoinducer-2 in Enteric Bacteria. ACS Chem. Biol. 2, 128–136 (2007).
Papenfort, K. & Bassler, B. L. Quorum sensing signal–response systems in Gram-negative bacteria. Nat Rev Microbiol 14, 576–588 (2016).
Stephens, K. & Bentley, W. E. Synthetic Biology for Manipulating Quorum Sensing in Microbial Consortia. Trends in Microbiology 28, 633–643 (2020).
Waters, C. M. & Bassler, B. L. QUORUM SENSING: Cell-to-Cell Communication in Bacteria. 31 (2005).
Ahmer, B. M. M. Cell-to-cell signaling in Escherichia coli and Salmonella enterica: Quorum sensing in E. coli and Salmonella. Molecular Microbiology 52, 933–945 (2004).
Barnes, M. E. A Review of Flavobacterium Psychrophilum Biology, Clinical Signs, and Bacterial Cold Water Disease Prevention and Treat. TOFISHSJ 4, 40–48 (2011).
Federle, M. J. Autoinducer-2-Based Chemical Communication in Bacteria: Complexities of Interspecies Signaling. in Contributions to Microbiology (eds. Collin, M. & Schuch, R.) vol. 16 18–32 (KARGER, 2009).
Pereira, C. S., Thompson, J. A. & Xavier, K. B. AI-2-mediated signaling in bacteria. FEMS Microbiol Rev 37, 156–181 (2013).
Sun, J., Daniel, R., Wagner-Döbler, I. & Zeng, A.-P. Is autoinducer-2 a universal signal for interspecies communication: a comparative genomic and phylogenetic analysis of the synthesis and signal transduction pathways. BMC Evol Biol 4, 36 (2004).
Balestrino, D., Haagensen, J. A. J., Rich, C. & Forestier, C. Characterization of Type 2 Quorum Sensing in Klebsiella pneumoniae and Relationship with Bioﬁlm Formation. J. BACTERIOL. 187, 11 (2005).
Vuotto, C. et al. Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol 123, 1003–1018 (2017).
Manage, P. M. Heavy use of antibiotics in aquaculture: Emerging human and animal health problems – A review. Sri Lanka J. Aquat. 23, 13 (2018).
Fursov, M. V. et al. Antibiofilm Activity of a Broad-Range Recombinant Endolysin LysECD7: In Vitro and In Vivo Study. Viruses 12, 545 (2020).
Levipan, H. A. & Avendaño-Herrera, R. Different Phenotypes of Mature Biofilm in Flavobacterium psychrophilum Share a Potential for Virulence That Differs from Planktonic State. Front. Cell. Infect. Microbiol. 7, (2017).
Castillo, D. & Middelboe, M. Genomic diversity of bacteriophages infecting the fish pathogen Flavobacterium psychrophilum. FEMS Microbiology Letters 363, fnw272 (2016).
Zhang, Y. et al. MazF Cleaves Cellular mRNAs Specifically at ACA to Block Protein Synthesis in Escherichia coli. Molecular Cell 12, 913–923 (2003).
Knecht, L. E., Veljkovic, M. & Fieseler, L. Diversity and Function of Phage Encoded Depolymerases. Front. Microbiol. 10, 2949 (2020).
Latka, A., Maciejewska, B., Majkowska-Skrobek, G., Briers, Y. & Drulis-Kawa, Z. Bacteriophage-encoded virion-associated enzymes to overcome the carbohydrate barriers during the infection process. Appl Microbiol Biotechnol 101, 3103–3119 (2017).
Burridge, L., Weis, J. S., Cabello, F., Pizarro, J. & Bostick, K. Chemical use in salmon aquaculture: A review of current practices and possible environmental effects. Aquaculture 306, 7–23 (2010).
Hansson, M., Nygren, P.-A. & Ståhl, S. Design and production of recombinant subunit vaccines. Biotechnology and Applied Biochemistry 32, 95–107 (2000).
Holten-Andersen, L., Doherty, T. M., Korsholm, K. S. & Andersen, P. Combination of the Cationic Surfactant Dimethyl Dioctadecyl Ammonium Bromide and Synthetic Mycobacterial Cord Factor as an Efficient Adjuvant for Tuberculosis Subunit Vaccines. Infection and Immunity 72, 1608–1617 (2004).
Shin, C., Kang, Y., Kim, H.-S., Shin, Y. K. & Ko, K. Immune response of heterologous recombinant antigenic protein of viral hemorrhagic septicemia virus (VHSV) in mice. Anim Cells Syst (Seoul) 23, 97–105 (2019).
Nelson, S. S., Bollampalli, S. & McBride, M. J. SprB Is a Cell Surface Component of the Flavobacterium johnsoniae Gliding Motility Machinery. Journal of Bacteriology 190, 2851–2857 (2008).
Maurice, S., Nussinovitch, A., Jaffe, N., Shoseyov, O. & Gertler, A. Oral immunization of Carassius auratus with modified recombinant A-layer proteins entrapped in alginate beads. Vaccine 23, 450–459 (2004).
Béarzotti, M. et al. The glycoprotein of viral hemorrhagic septicemia virus (VHSV): antigenicity and role in virulence. Veterinary Research 26, 413–422 (1995).
Mt, H. Technical aspects of the administration of vaccines. Dev Biol Stand 90, 79–89 (1997).
Midtlyng, P. J. et al. Three Rs approaches in the production and quality control of fish vaccines. Biologicals 39, 117–128 (2011).
Kwon, K.-C., Lamb, A., Fox, D. & Porphy Jegathese, S. J. An evaluation of microalgae as a recombinant protein oral delivery platform for fish using green fluorescent protein (GFP). Fish & Shellfish Immunology 87, 414–420 (2019).
Lee, K. Y. & Mooney, D. J. Alginate: properties and biomedical applications. Prog Polym Sci 37, 106–126 (2012).
ALGINATE. Fao.org at http://www.fao.org/3/y4765e/y4765e08.htm
Xu, F., Wang, P., Zhang, Y.-Z. & Chen, X.-L. Diversity of Three-Dimensional Structures and Catalytic Mechanisms of Alginate Lyases. Appl. Environ. Microbiol. 84, (2018).
Tavafi, H., Abdi- Ali, A. A., Ghadam, P. & Gharavi, S. Screening of Alginate Lyase-Producing Bacteria and Optimization of Media Compositions for Extracellular Alginate Lyase Production. Iran Biomed J 21, 48–56 (2017).
Gupta, S. et al. Macroalga-Derived Alginate Oligosaccharide Alters Intestinal Bacteria of Atlantic Salmon. Front Microbiol 10, (2019).
Caswell, R. C., Gacesa, P., Lutrell, K. E. & Weightman, A. J. Molecular cloning and heterologous expression of a Klebsiella pneumoniae gene encoding alginate lyase. Gene 75, 127–134 (1989).
Sepúlveda, D. et al. Time-course study of the protection induced by an interferon-inducible DNA vaccine against viral haemorrhagic septicaemia in rainbow trout. Fish & Shellfish Immunology 85, 99-105 (2019).
de Kinkelin, P. et al. Eighteen years of vaccination against viral haemorrhagic septicaemia in France. Vet. Res. 26, 379–387 (1995).

Difference between revisions of "Team:Vilnius-Lithuania/Design"

Latest revision as of 00:08, 19 December 2020

Loading...

References

contact us

follow us

project

wet lab

dry lab

human practices

team

@@ Line 11: / Line 11: @@
          <link rel="stylesheet" type="text/css" href="https://2020.igem.org/wiki/index.php?title=Template:Vilnius-Lithuania/CSS/SmallIndex&action=raw&ctype=text/css" />
          <link rel="stylesheet" type="text/css" href="https://2020.igem.org/wiki/index.php?title=Template:Vilnius-Lithuania/CSS/Design&action=raw&ctype=text/css" />
+<script>
+        document.getElementById("fixedOverlay").classList.add("wl");
+    </script>
+<style>
+#HQ_page table td{
+padding: 5px !important;
+}
+.sequences {
+word-break: break-all;
+}
+</style>
 </head>
@@ Line 19: / Line 29: @@
 			<div id="image-overlay"></div>
 		</span>
-		<div class="heading"></div>
+		<div class="heading">Design</div>
-		<div class="heading other"></div>
+		<div class="heading other">Design</div>
 		<input id="headingTitleText" type="hidden" value="Design" />
 		<script type="text/javascript" src="https://2020.igem.org/wiki/index.php?title=Template:Vilnius-Lithuania/JS/ContentPage&action=raw&ctype=text/javascript"></script>
@@ Line 83: / Line 93: @@
 				<div class="h3">Overview</div>
 				<p style="margin-bottom: 8px;">
-					During the past few years, <b>recirculatory aquaculture systems (RAS)</b> became a widely used system for cold-water fish production. With the benefits of these systems, infections also have taken its place. One of the broadest ranges of any fish bacterial pathogens constitutes <b><i>Flavobacterium columnare</i></b> and <b><i>Flavobacterium psychrophilum</i></b> bacteria, which causes columnariosis and cold-water disease or rainbow trout fry syndrome, respectively. The biggest issue with these diseases is high mortality rates, which often reaches 70 % of the infected fish population only in 24-72 hours<sup>1</sup>. Due to this rapid spread of infections, there is a massive demand for the point-of-care diagnostic systems, which could identify an exact species of Flavobacterium genus.
+					During the past few years, <b>recirculatory aquaculture systems (RAS)</b> became a widely used system for cold-water fish production. With the benefits of these systems, infections also have taken its place. One of the broadest ranges of any fish bacterial pathogens constitutes <b><i>Flavobacterium columnare</i></b> and <b><i>Flavobacterium psychrophilum</i></b> bacteria, which causes columnariosis and cold-water disease or rainbow trout fry syndrome, respectively. The biggest issue with these diseases is high mortality rates, which often reaches 70 % of the infected fish population only in 24-72 hours<a href="#citations" class="citation">1</a>. Due to this rapid spread of infections, there is a massive demand for the point-of-care diagnostic systems, which could identify an exact species of Flavobacterium genus.
 				</p>
 				<p>
@@ Line 102: / Line 112: @@
 				<div class="h3">Bioinformatic Analysis</div>
 				<p>
-					Since we wanted to differentiate between <i>Flavobacterium</i> species, instead of antibody-antigen interaction, our detection test is based on <b>nucleic acid hybridization</b>. We found out that for identification purposes, nucleic acids are a more reliable and specific source than antibodies<sup>2</sup>.
+					Since we wanted to differentiate between <i>Flavobacterium</i> species, instead of antibody-antigen interaction, our detection test is based on <b>nucleic acid hybridization</b>. We found out that for identification purposes, nucleic acids are a more reliable and specific source than antibodies<a href="#citations" class="citation">2</a>.
 				</p>
 				<p>
-					The first step in developing a lateral flow assay test based on nucleic acid hybridization is choosing <b>marker genes</b>, which allows us to identify an exact bacteria species. According to our literature research, <b>16S rRNA gene</b> is a suitable candidate for this purpose because it is present in almost all bacteria and its function did not change over time<sup>3</sup>. Also, we found that single copy <b>rpoC gene</b> coding β' DNA-dependent RNA polymerase can be used as a marker for <i>F. psychrophilum</i> species<sup>4</sup>. As well as cslA gene coding chondroitin AC lyase for <i>F. columnare</i> species<sup>5</sup>.
+					The first step in developing a lateral flow assay test based on nucleic acid hybridization is choosing <b>marker genes</b>, which allows us to identify an exact bacteria species. According to our literature research, <b>16S rRNA gene</b> is a suitable candidate for this purpose because it is present in almost all bacteria and its function did not change over time<a href="#citations" class="citation">3</a>. Also, we found that single copy <b>rpoC gene</b> coding β' DNA-dependent RNA polymerase can be used as a marker for <i>F. psychrophilum</i> species<a href="#citations" class="citation">4</a>. As well as cslA gene coding chondroitin AC lyase for <i>F. columnare</i> species<a href="#citations" class="citation">5</a>.
 				</p>
 				<p>
@@ Line 111: / Line 121: @@
 				</p>
 				<p>
-					The detection probe is used to <b>functionalize</b> gold nanoparticles, meaning that a part of the sequence is adsorbed by the gold nanoparticle. If the probe sequence is unmodified then after conjugation with the gold nanoparticle it can lose its molecular recognition function<sup>6</sup>. For this reason, a poly-A sequence followed by the thiol group (ThioMC6-D, IDT) is added to the 5' end and the rest of the sequence is left free for hybridization.
+					The <b>detection probe</b> is used to <b>functionalize</b> gold nanoparticles, meaning that a part of the sequence is adsorbed by the gold nanoparticle. If the probe sequence is unmodified then after conjugation with the gold nanoparticle it can lose its molecular recognition function<a href="#citations" class="citation">6</a>. For this reason, a <b>poly-A sequence</b> followed by the <b>thiol group</b> (ThioMC6-D, IDT) is added to the 5' end and the rest of the sequence is left free for hybridization.
 				</p>
 				<p>
-					The capture probe also has a 3' modification of poly-A to make sure that the probe sequence itself is available for hybridization followed by biotin moiety (bio, IDT). Biotin modification is needed so that the probe could be immobilized on the test line of the lateral flow assay test strip via biotin-streptavidin non-covalent interaction. Control probe has a 5' biotin (biosg, IDT) moiety for the same reason as well.
+					The <b>capture probe</b> also has a 3' modification of <b>poly-A</b> to make sure that the probe sequence itself is available for hybridization followed by <b>biotin moiety</b> (bio, IDT). Biotin modification is needed so that the probe could be immobilized on the test line of the lateral flow assay test strip via biotin-streptavidin non-covalent interaction. <b>Control probe</b> has a 5' <b>biotin moiety</b> (biosg, IDT) for the same reason as well.
 				</p>
 				<p>
-					In our case, the detection and capture probes were created to be complementary to the negative strand of the gene (table 1). Control probe is complementary only to the detection probe.
+					In our case, the detection and capture probes were created to be complementary to the <b>negative strand</b> of the gene (table 1). Control probe is complementary only to the detection probe.
 				</p>
 				<p>
-					After creating ssDNA probes for lateral flow assay, primers for HDA meant to amplify fragments with probe hybridization sites were created using the <a target="_blank" href="https://international.neb.com/faqs/2011/07/17/how-to-design-the-primer-and-select-the-amplicon-for-isoamp-ii-universal-thda-kit">IDT PrimerQuest tool</a> and following manufacturers recommended parameters: GC % 30 - 60%, Tm 60°C - 80°C, size 20 - 35 bp.
+					After creating ssDNA probes for lateral flow assay, <b>primers for HDA</b> meant to amplify fragments with probe hybridization sites were created using the <a target="_blank" href="https://international.neb.com/faqs/2011/07/17/how-to-design-the-primer-and-select-the-amplicon-for-isoamp-ii-universal-thda-kit">IDT PrimerQuest tool</a> and following manufacturers recommended parameters: GC % 30 - 60%, Tm 60°C - 80°C, size 20 - 35 bp.
 				</p>
 				<p>
@@ Line 130: / Line 140: @@
 					</thead>
 					<tbody>
-						<tr><td><i>F. columnare</i> 16S rRNA gene</td><td><u>CAGGGGGAT<wbr>AGCCCAGAGA<wbr>AATTTGG</u>ATTAAT<wbr>ACCCCATAGT<wbr>AT<b class="bluer">TTTCA<wbr>GATG</b><b class="yellower">GCCTCATT<br>TGATT</b>ATTAAAGTT<wbr>CCAACGGTACAA<wbr>GATGAGCA<u>TGCGTCCCAT<wbr>TAGCTAGTTGGT<wbr>GTGGT</u></td></tr>
+						<tr><td><i>F. columnare</i> 16S rRNA gene</td><td class="sequences"><u>CAGGGGGATAGCCCAGAGAAATTTGG</u>ATTAATACCCCATAGTAT<b class="bluer">TTTCAGATG</b><b class="yellower">GCCTCATTTGATT</b>ATTAAAGTTCCAACGGTACAAGATGAGCA<u>TGCGTCCCATTAGCTAGTTGGTGTGGT</u></td></tr>
-						<tr><td><i>F. columnare cslA</i> gene</td><td><u>AATGACTTCAA<wbr>CTAGA</u><b class="bluer"><u>ACAGTAG<wbr>GTGCTGA</u>AGCAGG</b>TAATAA<wbr>TT<b class="yellower">CAG<br>G<wbr>GAATTATAACT<wbr>ATTATG</b>C<u>AGGGGCAGGA<wbr>GTGAATTACACAAT<wbr>TCATA</u></td></tr>
+						<tr><td><i>F. columnare cslA</i> gene</td><td  class="sequences"><u>AATGACTTCAACTAGA</u><b class="bluer"><u>ACAGTAGGTGCTGA</u>AGCAGG</b>TAATAATT<b class="yellower">CAGGGAATTATAACTATTATG</b>C<u>AGGGGCAGGAGTGAATTACACAATTCATA</u></td></tr>
-						<tr><td><i>F. psychrophilum</i> 16S rRNA gene</td><td><u>GGATAGCCC<wbr>AGAGAAATTT<wbr>GGA</u>TTAAT<wbr>ACCTCATAGT<wbr>AT<b class="bluer">AGTGA<wbr>GTTG</b><b class="yellower">GCA<wbr>TCAAC<br>ACACT</b>ATTAAAGTCACA<wbr>ACGGTAAAAGA<wbr>TGAGCA<u>TGCGTCCCAT<wbr>TAGCTAGTTG</u></td></tr>
+						<tr><td><i>F. psychrophilum</i> 16S rRNA gene</td><td  class="sequences"><u>GGATAGCCCAGAGAAATTTGGA</u>TTAATACCTCATAGTAT<b class="bluer">AGTGAGTTG</b><b class="yellower">GCATCAACACACT</b>ATTAAAGTCACAACGGTAAAAGATGAGCA<u>TGCGTCCCATTAGCTAGTTG</u></td></tr>
-						<tr><td><i>F. psychrophilum rpoC</i> gene</td><td><u>ACGGGTAT<wbr>TCTTCTTGCTAC<wbr>AAATA</u>AT<b class="bluer">ATTCCT<wbr>TACGGTTCAAG<wbr>TAT</b>TTATG<br>T<b class="yellower">AAATGAC<wbr>GCTCAAGT<wbr>TGTAG</b>AAAAA<u>GGAGATGT<wbr>TATTTGTAAATGGG<wbr>ATCC</u></td></tr>
+						<tr><td><i>F. psychrophilum rpoC</i> gene</td><td  class="sequences"><u>ACGGGTATTCTTCTTGCTACAAATA</u>AT<b class="bluer">ATTCCTTACGGTTCAAGTAT</b>TTATG<br>T<b class="yellower">AAATGACGCTCAAGTTGTAG</b>AAAAA<u>GGAGATGTTATTTGTAAATGGGATCC</u></td></tr>
 					</tbody>
 				</table>
@@ Line 149: / Line 159: @@
 				</p>
 				<p>
-					By leading these main requirements, we have distinguished some isothermal amplification methods such as helicase-dependent amplification (<b class="semi">HDA</b>), loop-mediated isothermal amplification (<b class="semi">LAMP</b>), strand-displacement amplification (<b class="semi">SDA</b>) and rolling circle amplification (<b class="semi">RCA</b>)<sup>7</sup>.
+					By leading these main requirements, we have distinguished some isothermal amplification methods such as <b>helicase-dependent amplification</b> (<b class="semi">HDA</b>), loop-mediated isothermal amplification (<b class="semi">LAMP</b>), strand-displacement amplification (<b class="semi">SDA</b>) and rolling circle amplification (<b class="semi">RCA</b>)<a href="#citations" class="citation">7</a>.
 				</p>
 				<p>
-					However, LAMP, SDA or RCA amplification methods have their own limitations such as complicated reaction schemes or multiplex sets of primers. Also, it should be mentioned that each of these methods are incapable of amplifying DNA targets of sufficient length required for lateral flow assay test<sup>8</sup>.
+					However, LAMP, SDA or RCA amplification methods have their own limitations such as complicated reaction schemes or multiplex sets of primers. Also, it should be mentioned that each of these methods are incapable of amplifying DNA targets of sufficient length required for lateral flow assay test<a href="#citations" class="citation">8</a>.
 				</p>
 				<p>
-					After further analysis, we found out that in order to fulfil these goals, <b>helicase-dependent amplification</b> would be a perfect solution. This method allows us to make our detection test as specific as possible by using an exact length of target sequences. Thus, it provides a simple reaction scheme and enables the generation of single-stranded DNA fragments, which are essential for lateral flow assay test development<sup>9</sup>.
+					After further analysis, we found out that in order to fulfil these goals, <b>helicase-dependent amplification</b> would be a perfect solution. This method allows us to make our detection test as specific as possible by using an exact length of target sequences. Thus, it provides a simple reaction scheme and enables the generation of single-stranded DNA fragments, which are essential for lateral flow assay test development<a href="#citations" class="citation">9</a>.
 				</p>
 			</div>
@@ Line 167: / Line 177: @@
 		<div class="scrollBlock" style="height:unset;grid-template-rows:auto auto">
 			<div class="scrollItem">
-				<svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 903.96 987.62"><style>.G,.H,.I,.j,.k,.l,.m,.J,.K,.p{isolation:isolate}.H{letter-spacing:-0.01em}.J{letter-spacing:-0.04em}.K{letter-spacing:-0.04em}.L{font-family:montserrat-light,sans-serif}.M{font-weight:300}.N{font-size:36px}.O{stroke-miterlimit:10}.P{fill:#ffd762}.Q{fill:#6281ef}.R{fill:#2e64ec}></style><g stroke="#ffc43b" stroke-width="3.78" class="O P"><path d="M86.06 693.34c4.22-9.4 11.1-18.23 20.7-22.06 11.3-4.5 24-1.36 35.4 2.77s22.8 9.3 34.92 8.8 25.08-9.14 25.36-21.2c.18-7.37-4.27-14.06-5.1-21.37-1.17-10.13 4.93-20.1 13.2-26.23s18.4-9 28.4-11.42c12.4-3 29.07-3.17 33.66 8.6 1.57 4 1.15 8.53.7 12.85-2.26 22.08-5.64 46.4-22.47 61.07-17 14.84-44.85 16.7-56.24 36.17-8.17 14-4.25 31.85 3.1 46.12 2.4 4.66 5.23 9.67 4.18 14.83-.7 3.37-2.93 6.2-5.1 8.86-4.9 6-12.75 12.7-19.37 8.73-2.22-1.33-3.66-3.64-5.65-5.3-4.92-4.1-13.3-3.15-17.23 2s-2.66 13.4 2.65 17c6.35.45 8.42-10.22 14.75-11.07 2.56-.34 5 1.1 7.36 2 11 4.25 24.12-3.27 29.36-13.93s4.26-23.28 1.37-34.72c-2.4-9.5-6-19.4-3.26-28.85 3.52-12 15.86-18.78 26.45-25.54 27.35-17.5 50.45-45.8 51.16-78 .22-9.86-1.95-20.28-8.67-27.47-13.8-14.73-38.1-9.34-57.4-2.8-17.64 6-38.56 16.18-39.15 34.7-.23 7.16 2.9 13.9 4.42 20.9s.94 15.43-4.82 19.77c-5.2 3.93-12.44 3-18.82 1.83l-44.8-8c-8.2-1.47-16.77-2.92-24.75-.43-14.62 4.58-22.24 20.56-26 35.35-5.1 20-6.2 41.77 1.92 60.62s27.07 33.88 47.74 33c19.22-.84.43-11.62-3-14-9.18-6.5-16.2-13.08-21.7-23.24-9.8-18.26-11.84-41.1-3.23-60.3z"/><path d="M153.33 679.33c-2.12 1.93-3.86 4.24-6.33 5.8-10 6.36-29.5-3.68-35.34-16.8s.26-25.92 11.46-30.82 26.22-3.18 40.43 1.25c9.15 2.86 19.93 6.68 25.87 2 11.35-8.9-10.52-32.4-5.46-46 3.06-8.26 14.85-9.3 25.4-7.66 9 1.4 18.67 4.35 26.47 10.56 16.26 12.92 17.94 33.4 17.76 50.23-.14 13.2-.34 26.67-5.44 37.75s-16.14 19.5-30.7 18.26c-12.42-1.07-26.3-8.9-37.4-6.4-9.5 2.13-13.78 11.93-11.47 22s10.2 19.88 19.54 27.18c11.3 8.84 26.9 14.52 36.75 9.44 8.47-4.37 12.3-16 23.45-14.35 6.72 1 13.08 6.94 16.5 13.05 8 14.3 2.75 29.8-9.58 35.44s-29.88 2.63-45.16-5.13-28.58-19.73-40.25-32.36c-10.6-11.46-20.44-23.92-33.4-32.92S106 706.3 96.55 713.5c-2.64 2-4.54 5.14-3.68 8.87 1.62 7 12.2 11.63 18.6 9.73s9.56-7.8 12.32-13.36c25.2 12.8 32.2 43.88 52.48 63.84 21.63 21.25 53.75 25.46 79.2 22.17 14.18-1.84 28.75-6.32 33.13-18.43 5.07-14-6.07-33.57-21.37-45.92-5.8-4.68-12.4-8.73-19.2-10.34-9.78-2.32-18.4.67-26.32 3.72s-16.37 6.2-26.14 4.2-20.7-11.46-19.87-19.93c.62-6.34 7.42-9.38 14.45-9.38s14.5 2.27 21.76 3.27c24.4 3.4 44.86-8.45 53.5-26.75s6.6-42.1-1.55-65c-4.57-12.8-11.64-26.32-23.7-35.5-16.83-12.8-38.72-13.3-53.94-6.7-10.56 4.56-19.54 14-15.9 26.4 1.6 5.5 5.52 10.85 7.23 16.36s0 11.9-5.74 11.74c-2.56-.07-5.24-1.43-7.82-2.6-32.5-14.85-68.34-1.9-72.8 26.33-1.1 7-.3 15.25 4.9 22.35 4.6 6.28 12 10.7 19.26 13.4 13.74 5.1 28.1 4.82 38.38-.76 5.4-2.93 25.48-5.73 25-12.72-.84-12.06-21.75-2.5-25.42.83z"/><path d="M313.7 681.17c-.77 8.8-9.87 15.42-18.7 15.06s-16.7-6.46-21-14.16c-3.54-6.3-5-13.55-8.25-20-8.7-17.44-28.17-26.23-46.17-33.7-9.5-4-20.82-7.78-29.53-2.33-6.82 4.27-9.66 13-16.14 17.73-5.94 4.36-13.9 4.67-21.23 3.87a87.31 87.31 0 0 1-50-23.09c-2.7-2.54-5.28-5.3-8.6-6.93-10.33-5.08-23.86 4.76-24 16.27s10.86 21.26 22.35 21.9c8 .45 15.8-2.66 23.83-3 11.75-.45 22.75 5.05 34.05 8.2s25.1 3.38 32.94-5.37c2.6-2.9 4.3-6.56 7.13-9.22 7.3-6.85 19.3-4.76 28 .2 12.8 7.26 22.13 19.22 31 30.9s18.1 23.72 30.74 31.27 29.7 9.6 41.66 1c12.15-8.73 15.46-26.54 10-40.47s-18.13-24.07-32-29.75c-8.76-3.6-21.22-4.36-25.37 4.16-2.82 5.78.27 13 5.32 17 9.8 7.76 35.58 2 33.97 20.45z"/><path d="M224.75 549.3c-7.08-2.62-14.2-3-26.14-4.7-5.66-.8-12.32 2-16.38 6-2.7 2.7-2.5 7.08-1.87 10.84a83.64 83.64 0 0 0 16.79 37.7c4.74 6 10.65 12.22 10.34 19.85-.4 9.7-10.7 16.38-12.45 25.92-2.33 12.66 10.53 22.3 21.27 29.4 11.46 7.6 22.58 16.32 29.9 28s10.27 26.7 4.8 39.35c-6.3 14.5-23.93 23-39.17 18.84-10.76-2.92-19.3-11-29.22-16s-23.86-6.27-30.65 2.58-2.28 21.46 1.7 31.9c3.5 9.17 23.53 70.57-2.4 56.64-22.92-12.3-20.86-64.2-23.25-84.85-.28-2.4-.55-4.9.2-7.2 1.1-3.28 4-5.54 6.8-7.57 10.8-7.88 22.16-15.8 35.3-18.26s28.56 2.15 34.65 14c1.93 3.78 2.95 8.2 6.1 11.06 4.6 4.16 12.4 3 16.86-1.33s6-10.93 5.83-17.14a39.52 39.52 0 0 0-15.54-30.18c-9-6.75-20.5-9.35-29.68-15.8a43 43 0 0 1-17.32-41.3c1.55-9.32 6.22-18 6.77-27.47.88-14.9-8.5-28.2-17.25-40.28-2.87-4-5.83-8.25-6.1-13.14-.43-8 6.36-14.42 13.32-18.28 15.93-8.86 39.5-4.2 59.12-.34"/><path d="M161.88 628c-.5 4.1-1.73 8.14-1.55 12.27a23.17 23.17 0 0 0 4.67 12.49c8.26 11.36 24.75 15.85 37.63 10.25 4.35-1.9 8.3-4.8 13-5.77 9.9-2.1 19.18 4.93 26.87 11.5 4.16 3.56 8.5 7.38 10.32 12.55 4.06 11.63-6.17 24.8-1.8 36.32 4 10.52 17.3 13.22 28.45 14.9s24.5 6.12 26.38 17.22c.83 4.83-.9 9.72-2.85 14.23-4.13 9.6-9.8 19.25-19.1 24-11.17 5.7-24.55 3-36.92.92s-26.57-2.8-35.88 5.6c-6.46 5.84-9 14.85-14.55 21.6-10.83 13.2-30.18 15-47.25 14.26-8.7-.36-18.32-1.54-24.13-8.05-3.27-3.67-4.83-8.56-5.74-13.4A64.77 64.77 0 0 1 124.7 769c3.92-8.1 9.55-15.4 12.43-23.93A40.4 40.4 0 0 0 102 691.85c-2.74-.22-6.17.3-7.1 2.88-.6 1.72.22 3.6 1.07 5.22 3.85 7.38 8.4 14.5 10.68 22.52a42.79 42.79 0 0 1-44.86 54.36c-5.48-.48-11.12-2.18-15-6.14s-5.25-10.56-2.14-15.1c2.37-3.45 6.75-5 10.94-5.2 12.6-.5 26.2 9.47 36.8 2.63 9.65-6.2 7.74-20.93 2.77-31.27s-12-21.3-9-32.36c3.2-11.56 17.16-17.6 29-15.35s21.45 10.7 29.08 20c7.14 8.7 13.15 18.6 15.64 29.56s1.17 23.13-5.27 32.35c-7.57 10.85-21.9 17.9-23.66 31a22.57 22.57 0 0 0 3.23 14.27 28.38 28.38 0 0 0 47.85 1.78c7.5-10.86 7.44-26.77 18-34.75 9.9-7.5 23.88-4.1 35.77-.57s26.18 6.32 35.5-1.82c2.23-1.94 4.06-4.65 3.94-7.6-.13-3.15-2.42-5.78-4.85-7.8-8.2-6.8-18.86-9.62-28.38-14.38s-18.77-13-19.07-23.62c-.28-10 7.36-20.54 2.4-29.22-3.87-6.77-13.37-7.82-20.94-6s-14.7 5.82-22.5 6.18c-14.87.68-27.12-11.84-34.07-25-1.85-3.52-3.52-7.26-3.76-11.23s1.06-8.12 1.8-12.16c2.08-11.3-1.1-24.47-10.86-30.53s-25.68-.3-26.3 11.17c-.54 9.92 9.36 17.7 10.3 27.58.88 9.5-8.56 18.5-18 17.2-5.8-.8-10.7-4.7-16.38-6.14-10.46-2.64-22.36 5-24.3 15.6-1.5 8.23.45 19.85-7.57 22.25a27.3 27.3 0 0 1 22.05-45.57c6.9.46 13.42 3.52 20.32 3.84s15-3.73 15.26-10.63c.2-5.23-4.1-9.36-6.8-13.84a25.58 25.58 0 0 1 0-25.89c18.4-30.5 61.87-.9 58.3 27.92z"/></g><g stroke="#4675eb" stroke-width="4" class="Q O"><path d="M572.33 782.9c4.22-9.42 11.1-18.24 20.7-22.07 11.3-4.5 24-1.36 35.4 2.77s22.8 9.3 34.92 8.8 25.08-9.14 25.36-21.2c.18-7.37-4.27-14.05-5.1-21.37-1.17-10.13 4.93-20.1 13.2-26.23s18.4-9 28.4-11.42c12.4-2.95 29.07-3.17 33.65 8.6 1.57 4 1.16 8.54.7 12.85-2.25 22.08-5.63 46.4-22.46 61.07-17 14.85-44.85 16.7-56.25 36.17-8.16 14-4.24 31.85 3.1 46.12 2.4 4.66 5.23 9.67 4.18 14.84-.7 3.36-2.93 6.18-5.1 8.85-4.9 6-12.75 12.7-19.36 8.73-2.23-1.33-3.66-3.63-5.65-5.3-4.92-4.1-13.3-3.15-17.24 2s-2.65 13.4 2.65 17c6.36.44 8.43-10.23 14.76-11.07 2.56-.35 5 1.1 7.36 2 11 4.25 24.12-3.26 29.35-13.93s4.27-23.28 1.38-34.72c-2.4-9.5-6-19.4-3.26-28.85 3.52-12 15.86-18.77 26.44-25.54 27.36-17.5 50.46-45.8 51.17-78 .22-9.87-2-20.3-8.68-27.48-13.8-14.73-38.1-9.34-57.4-2.8-17.64 6-38.56 16.2-39.16 34.7-.23 7.16 2.9 13.92 4.42 20.9s.94 15.43-4.8 19.77c-5.2 3.93-12.44 3-18.83 1.83l-44.8-8c-8.2-1.47-16.77-2.92-24.74-.43C562 756 554.37 772 550.6 786.8c-5.1 20-6.2 41.77 1.93 60.62s27.07 33.88 47.74 33c19.2-.83.43-11.62-3-14-9.18-6.5-16.2-13.1-21.72-23.25-9.8-18.16-11.83-41.04-3.2-60.25z"/><path d="M647.08 816.16c1.7 3.15 3.8 6.1 5.08 9.43 5.2 13.5-7.26 28.33-21.15 27.67s-26-13.42-29.62-27.37 0-28.46 6.14-40.76c4-7.92 9.12-17 5.15-25.46-7.6-16.14-33.86-5.66-46.95-17.75-7.94-7.33-7.56-19.92-4.64-29.88 2.5-8.54 6.63-16.9 13.82-21.75 15-10.1 35.76-1.43 52.68 7.3 13.25 6.83 26.78 13.88 37.32 24.72s17.67 26.42 14.66 40.68c-2.57 12.17-12.1 22.42-10.94 35 1 10.8 10.34 20.16 20.7 22.88s21.23-.34 29.7-6.2c10.25-7.1 17.85-20.17 13.92-32.84-3.37-10.9-14.6-20.7-11.6-31.3 1.8-6.38 8.55-9.87 15.12-10.3 15.35-1 30.3 12.3 34.5 27.8s-1 31.93-10.62 43.63S737.07 831 723 836.52c-12.82 5-26.54 8.78-37.16 17.48s-17.33 24.28-11.22 37.6c1.7 3.73 4.62 7.27 8.48 8.28 7.26 1.9 13.18-6.58 12-14.12s-6.7-13.74-12-19.4c15.94-19.25 48.06-10.65 70.6-21.33 24-11.37 32.1-42.12 31.86-69.85-.13-15.45-2.9-32.65-14.53-43.27-13.48-12.3-34.5-10.82-48.78-1.42-5.4 3.56-10.28 8.27-12.73 14.4-3.5 8.84-1.54 19.18.57 28.84s4.28 19.9 1.1 28.9-14 15.4-22.45 10.24c-6.3-3.86-8.53-12.36-7.7-19.55s4-13.7 5.92-20.62c6.35-23.26-3.1-50.2-20.46-68.34S625 676.27 601 673c-13.44-1.82-27.88-1.43-38.56 6.25-14.92 10.73-18.05 32.9-13.27 51.82 3.32 13.13 11.7 27.1 24.65 29.68 5.74 1.15 11.58-.14 17.33.9s12 6 11.1 11.83c-.37 2.58-2.07 4.64-3.56 6.7-18.87 25.75-10.15 69 17.7 87.9 6.93 4.7 15.3 8 23.07 6.3 6.88-1.53 12.22-6.85 15.8-12.92 6.8-11.47 8.24-26.33 3.87-39.67-2.3-7-2.7-29-9.78-32-12.28-5.32-5.17 21-2.3 26.38z"/><path d="M576.94 746c1.56-7.43 9.74-11.6 17-9.83s13 8.33 15.8 15.66c2.24 6 2.7 12.47 4.66 18.56 5.3 16.43 20.37 27.2 34.37 36.62 7.4 5 16.28 10.14 24 6.9 6-2.53 9.3-9.54 15.14-12.55 5.34-2.76 11.92-1.7 17.86.2a78.75 78.75 0 0 1 38.63 28.13c1.94 2.63 3.78 5.43 6.34 7.38 7.95 6.08 20.1-.12 21.42-10s-6.66-20.06-16-22.52c-6.54-1.7-13.28-.33-19.9-1.4-9.7-1.56-18.16-8.12-27.1-12.73s-20.28-7.08-27.65-.86c-2.44 2.06-4.22 4.92-6.83 6.74-6.72 4.67-16.36.88-23-4.8-9.74-8.36-16.15-20.18-22.24-31.7s-12.37-23.4-21.95-32S584 714.62 573.3 720c-10.9 5.5-15.53 20.24-12.5 33.1s12.35 23.7 23.12 30.9c6.82 4.55 17 7.26 21.3.63 2.92-4.5 1.16-11.24-2.57-15.5-7.22-8.23-29-7.57-25.72-23.14z"/><path d="M714.5 653.63c3.7 5.43 9.62 14.57 13.63 24.54 1.9 4.74 1.1 11.43-1.3 16.2-1.6 3.18-5.2 4.32-8.4 4.88a63.36 63.36 0 0 1-34.43-3.49c-5.94-2.38-12.32-5.7-18.47-3.15-7.8 3.24-11 14.27-18.35 18.67-9.8 5.83-20.5-2.6-28.68-9.9-8.73-7.8-18.3-15-29.42-17.9S565 682.5 556 691c-10.4 9.85-13.4 27.87-6.64 40 4.77 8.57 13.2 13.66 19.55 20.86s10.4 19.1 4.72 27.7-17 8.4-26.37 8c-8.25-.33-62.7.4-45.6 19 15.12 16.45 56.94-.85 74.3-4.92a14.22 14.22 0 0 0 5.83-2.35c2.42-1.93 3.6-5.18 4.65-8.23 4-11.83 8-24.18 7-36.45s-8.1-24.43-19.14-26.23c-3.5-.57-7.35-.14-10.36-2-4.42-2.8-5.2-10-2.66-15.2s7.57-8.52 12.66-10.24a30 30 0 0 1 28 4.63c7.5 5.88 12.17 15.2 19.47 21.35 10.24 8.6 25.43 9.77 37.5 2.86 7.25-4.14 13.3-10.85 20.86-14.15 11.94-5.2 24.87-1 36.66 3.12 3.87 1.34 8 2.67 12 1.43 6.57-2 10.33-9.9 11.94-17.16 3.67-16.63-6.3-36.38-15.5-49.28"/><path d="M573.26 765.23c3.4 1.85 6.6 4.35 10.2 5.57a18.87 18.87 0 0 0 11.95-.21c11.9-3.9 20-17.78 18.4-31.7-.52-4.7-2-9.38-1.68-14 .7-9.94 9.12-16.25 16.75-21.22 4.14-2.7 8.53-5.47 13.46-5.42 11.06.1 19.83 14.1 30.88 13.9 10.1-.2 15.8-11.72 20.1-21.55s11.5-20.8 21.56-18.85c4.4.86 8.16 4.12 11.56 7.45 7.23 7.08 14.12 15.63 15.86 25.9 2.08 12.35-3.68 23.93-8.6 34.8s-9.17 23.87-4.3 35.4c3.4 8 10.52 13.43 14.93 20.86 8.65 14.55 5.26 33.22.3 48.92-2.53 8-6 16.6-13.08 19.83-4 1.82-8.62 1.63-13 .86a60.37 60.37 0 0 1-33.06-18.35c-6-6.38-10.87-14.1-17.5-19.65-9-7.57-21-10.46-31.54-7.6s-19.4 11.4-23.34 22.5c-.88 2.5-1.32 5.85.7 7.58 1.33 1.16 3.16 1 4.77.76 7.35-1.1 14.67-3 22.16-2.4 12.4.93 24.6 8.93 31.55 20.72s8.48 27 3.94 39.47c-1.8 5-4.7 9.66-9.1 11.9s-10.45 1.35-13.58-3.08c-2.38-3.37-2.63-8-1.7-12 2.78-12 14.84-21.3 11.64-33.5-2.9-11.1-16.1-14.27-26.3-13.1s-21.44 4.08-30.2-2.5c-9.17-6.9-10.82-21.94-5.9-32.2s14.7-16.44 24.63-20.44c9.3-3.75 19.38-6 29.48-4.67a38.58 38.58 0 0 1 26.58 15.8c7.43 10.72 9.88 26.46 20.74 32.52a18.92 18.92 0 0 0 13.14 1.79c8.28-1.74 15.3-8.45 18-17.2a32 32 0 0 0-4.35-26.9c-7.47-10.66-21.2-16-25.42-28.47-3.95-11.75 2.54-23.68 8.6-33.6s12.17-22.3 7.5-33.78c-1.1-2.73-3-5.35-5.56-6.23-2.75-.94-5.6.32-8 1.9-7.94 5.36-13.1 14.38-19.62 21.67s-16 13.16-25.23 9.86c-8.7-3.1-15.86-13.78-24.6-12.07-6.82 1.34-10.14 9.85-10.45 17.55s1.28 15.7-.4 23.1C623 779.27 609.1 786.5 596 788.57c-3.5.55-7.16.85-10.65-.27s-6.74-3.72-10-5.78c-9.2-5.74-21.4-7.2-29.1-.13s-6.78 23.9 3 28.33c8.42 3.85 17.64-2.8 26.4-.33 8.42 2.37 13.8 14.22 10.27 22.6-2.17 5.14-6.78 8.4-9.46 13.23-4.94 8.88-1.38 22.56 7.3 28 6.72 4.18 17.25 6.25 17.28 14.55-8.75 4.08-20 1.56-27.2-6.1s-9.9-20-6.53-29.8c2.15-6.28 6.44-11.35 8.47-17.7s.6-15.26-5.3-17.82c-4.46-1.94-9.12.66-13.67 1.7-7.9 1.77-16.83-1.7-22.34-8.7-21.8-27.53 14.8-58.16 38.77-45.1z"/></g><path d="M626.08 567.14c-1.4 1.17-2.87 2.48-3.17 4.27-.4 2.33 1.35 4.43 3 6.15l23.63 25.17c2.84 3 6.6 6.32 10.58 5.15a11.41 11.41 0 0 0 4.25-2.86l19.9-18.33a7.37 7.37 0 0 0 2.07-2.6c1.27-3.34-2.53-6.26-5.7-8-10.24-5.47-19.65-17-29.8-21.27s-16.48 5.38-24.75 12.32z" class="R"/><path d="M628.47 554.33c8.73 9.67 16.65 20.1 25 30.12l24.82 29.08c9.17 10.2 18.35 19.9 26.4 31.06 7 9.7 15.52 19.4 20.28 30.44 2.62 6.06 13 1.72 10.74-4.52-2.2-6-4.28-11.87-7.42-17.47s-7.23-10.63-11.08-15.77c-8.68-11.58-18.25-21.8-28.14-32.34-9.06-9.65-17.48-19.88-26.62-29.46a156.68 156.68 0 0 0-30.79-25.27c-2.6-1.62-5.12 2-3.18 4.13z" class="Q"/><path d="M477.34 342.77l5.1.37a26.53 26.53 0 0 0 5.17.67 3.45 3.45 0 0 0 .91-6.75c-3.53-1.18-8.3-.22-11.9.3-3.16.46-2.24 5.3.73 5.4zm-3.66 24.53c3.63.83 7.45.7 11.16.9a58.15 58.15 0 0 0 11.65-.12c4.75-.7 3-7.3-1.05-7.74-7-.78-14 1.65-20.93.83-3.5-.4-4.23 5.37-.83 6.14zm5.16 21.5l18 2.48c5.2.67 5.27-7.7 0-8.25a86 86 0 0 0-18 .15 2.81 2.81 0 1 0 0 5.62zm6.82 22.2l6.68-.6c2.23-.18 4.32.17 6.47-.22 3.25-.58 2.3-5.4-.74-5.52-2.08-.1-4.12.6-6.2.68l-6.2.28c-3.47.16-3.4 5.68 0 5.37zm-12.12-197.6h1s1 .1.5 0a15.09 15.09 0 0 1 2 .41 3.49 3.49 0 0 0 2.08-6.66A3.27 3.27 0 0 0 478 207a21.31 21.31 0 0 0-5.22.5 3 3 0 0 0 .8 5.89zm-1.1 24.66c3.16-.5 6.2.24 9.3.5a4.22 4.22 0 0 0 4.18-3.68 4.32 4.32 0 0 0-3.05-4.67c-4.27-1.47-9.13-.23-13 1.78a3.3 3.3 0 0 0-1.36 4.14 3.4 3.4 0 0 0 3.91 1.92zm4.43 24.64c.75-.14-.58-.05.1 0h.5c-.64-.17.2.07.34.1a4.06 4.06 0 0 0 1.2.18c-.66-.1-.77-.1-.33 0a4.14 4.14 0 0 0 5.065-2.935 4.14 4.14 0 0 0-2.935-5.065 4 4 0 0 0-1-.14 8.41 8.41 0 0 0-6 2.53 3.24 3.24 0 0 0-.5 3.86 3.36 3.36 0 0 0 3.6 1.47z" class="R"/><path d="M226.34 551.3a315.57 315.57 0 0 0 105.71-8.83c34.85-9 67.35-24.6 98.73-42 26.1-14.46 53.5-29.86 71.07-54.77 19.87-28.15 17.56-63.26 6.9-94.52-11.12-32.63-30.18-62.43-38.06-96.18a114.65 114.65 0 0 1 12-82.06c14-25 36.16-44.84 63.48-54 16.9-5.7 34.7-8 52.34-9.9 15.87-1.73 31.74-3.42 47.7-4.28 28-1.5 55.8.82 83.8 1.57 25 .67 51.46 1.2 75.73-5.6a61.33 61.33 0 0 0 14.2-5.73c8.14-4.7.8-17.35-7.38-12.62-9.14 5.3-19.87 7.37-30.2 9a306.88 306.88 0 0 1-38.9 3c-27 .67-54-1.8-81-.8-14.52.54-29 1.88-43.43 3.33-17.28 1.74-34.7 3.33-51.78 6.52-29.8 5.57-57.07 18.07-77.52 40.9a131 131 0 0 0-32.72 74.4c-3.1 32.18 9 62.25 22.06 91 13.67 30.17 29.7 63.54 23.48 97.65-5.6 30.77-29 50.8-54.43 66.4-29 17.8-59.83 34.58-92.05 45.66a315.8 315.8 0 0 1-103.18 17.06c-8.86 0-17.7-.44-26.54-1.2-10.25-.88-10.2 15.13 0 16z" class="P"/><path d="M712.7 635.35a604 604 0 0 0-111.83-118.41c-24.92-20.12-50.54-39.37-75.7-59.17-11.8-9.28-23.56-19-32.8-30.95a107 107 0 0 1-18.67-38.09c-7.88-29.6-.32-57.8 9-86.05 4.66-14.1 9.38-28.28 11.7-43a132.07 132.07 0 0 0-.71-44.48c-5.45-29.84-19.62-57.4-33.78-83.93-6.83-12.78-13.86-25.5-22.22-37.38s-18-21.77-28.42-31.7c-7.2-6.88-14.55-13.53-23.25-18.55-8-4.6-16.62-8.16-25-12-15.1-6.88-30.35-10.3-46.8-12.33a107.6 107.6 0 0 0-21.82-.89c-5.86.44-7.86 9.3-1.46 10.8 19.08 4.45 38.84 3.7 57.43 10.68 15.1 5.67 32.25 12.53 45 23.42 9.4 8 18.85 16.47 27 25.8 9.6 11 17.44 23.4 24.77 36 15.12 26 29.94 52.9 37.42 82.2a127.35 127.35 0 0 1 3.73 45.12c-1.58 14.65-6.06 28.87-10.6 42.83-9 27.77-18 55.13-13.52 84.7 4.28 28.16 19.14 52.5 40.08 71.44 11.44 10.34 23.9 19.55 36 29q19.3 15.1 38.66 30.1c43.48 33.75 83.24 71.85 119.66 113.13 4.22 4.8 8.27 9.73 12.24 14.72 1.75 2.2 5.58-.7 3.93-3z" class="Q"/><path d="M295.3 554.46c.07 3.4 0 6.86 1.2 10s3.77 6.1 7.13 6.5a13.49 13.49 0 0 0 4.29-.4l31.4-6.3c5.55-1.12 12.1-3.13 13.6-8.6.73-2.73-.08-5.6-.88-8.3L343.6 519c-.57-1.92-1.37-4.1-3.25-4.8a6.68 6.68 0 0 0-2.88-.18c-11.9 1-27.9 1.07-38.55 7.2-10.84 6.3-3.84 21.98-3.62 33.24z" fill="#ffc43b"/><path d="M263.38 8.4c-4-2.9-8-6-12.64-7.54S240.37-.3 236.88 3.18c-1.25 1.25-2.16 2.8-3.45 4C229 11.3 222 10 216.38 12.08c-5.78 2.18-9.6 8-11 14s-.94 12.28-.4 18.43c.3 3.6.66 7.32 2.45 10.46s5.43 5.52 8.94 4.67c1.92-.47 3.6-1.84 5.58-1.93 3.86-.16 6.12 4.56 5.85 8.4s-2 7.6-1.5 11.45c1 7.9 10.55 11.86 18.5 11.16s15.46-4.32 23.42-4.63c2.83-.1 5.8.17 8.35-1a14.26 14.26 0 0 0 4.86-4.34c4.38-5.5 8.15-12.4 6.7-19.27-.52-2.46-1.68-4.76-2-7.25-.7-5.4 2.74-10.68 7.3-13.66s12.08-6.46 17.45-7.38c.78-.13-8.68-6.64-9.46-7.2-3.93-2.92-8.1-3.78-12.77-4.63A57.38 57.38 0 0 1 263.38 8.4z" class="Q"/><path d="M807.05 98.3c-4.07.9-8.2 1.83-12.36 1.44s-8.38-2.3-10.5-5.9c-2.5-4.24-1.55-9.58-.83-14.46s.87-10.54-2.66-14a10.14 10.14 0 0 1-2.25-2.37 5.21 5.21 0 0 1 .35-4.28c3.14-7.12 12.3-10.9 19.56-8 1.7.66 3.35 1.65 5.17 1.6 2.68-.08 4.7-2.34 6.74-4.07A18 18 0 0 1 824 43.85a14.13 14.13 0 0 1 11.28 8.47c.76 1.93 1.06 4.1 2.4 5.7 2.9 3.47 8.63 2.2 12.56 4.45 5.16 2.94 5 11 1.22 15.57s-9.75 6.57-15.4 8.42S826.5 91 821.62 94c-4.34 2.63-9.62 3.18-14.57 4.3z" class="P"/><path d="M198.82 58c-4.25 3-10.62 5.08-14.28 1.37-1-1-1.68-2.32-3-2.76-1.77-.6-3.53.73-5.13 1.7-5.93 3.55-13.92 2.12-19.4-2.08s-8.78-10.7-10.8-17.3c-.7-2.25-1.26-4.66-.7-7 1-4 5.2-6.56 9.32-7.1s8.26.43 12.38.95 8.6.48 12.08-1.78c2.82-1.83 4.68-5 7.66-6.5 3.8-2 8.7-.93 12.1 1.73s5.5 6.62 7.06 10.64c5 12.9 4.34 19.85-7.27 28.15z" class="R"/><path d="M449.7 170.3a116.43 116.43 0 0 0-33.2-2.43 2.52 2.52 0 0 0-2.47 2.57 2.8 2.8 0 0 0 .08.57 986.85 986.85 0 0 1 12.07 106.8c2 33.62 1.16 67.67 7.5 100.87 3.53 18.47 13 37.6 10.37 56.7-.22 1.65.37 3.87 2.37 4.17l23.3 3.47c3.74.48 4.64-6 .9-6.63-7.44-1.28-14.93-2.27-22.4-3.37l2.5 3.27c2.16-16.67-4.32-32.34-8.4-48.18-4.44-17.24-6.46-35-7.65-52.7-2.38-35.6-3.08-71.13-7.2-106.6q-3.42-29.67-8.58-59.1l-2.4 3.14a189.07 189.07 0 0 1 32.7 1.13c2.1.23 2.52-3.2.5-3.66z" class="P"/><path d="M505.56 173.1l28.32 4.62c2.5.36 4.55.14 6.3 2s1.56 5.05 1.82 7.66q.8 7.8 1.55 15.58l5 57.6c2.6 38.6 3.1 77.55-1.5 116-2.6 21.72-7.5 43.22-7.2 65.2l3.76-3.77-22.66-.32c-4.72 0-4.68 7.1 0 7.32 7.55.34 15.1.42 22.66.53a3.81 3.81 0 0 0 3.76-3.76c-.45-20.67 3.84-40.9 6.36-61.32a485 485 0 0 0 3.47-61.31c-.15-41.5-4.43-82.84-9.35-124-.6-5.1-.8-10.45-1.82-15.48-.65-3.23-2.3-5.33-5.55-6.24-10.7-3-22.63-3.43-33.6-5-3-.42-4.33 4.1-1.27 4.6zM83.43 71.1c11.48-13.76 29.88-15.5 46.65-15.9a2.11 2.11 0 0 0 1.48-3.57 133.28 133.28 0 0 0-12.73-10l-2.14 3.67c3.16 1.7 7.4 4 9.33 7.06 2.1 3.33-1.9 7.15-3.44 10.17a2.61 2.61 0 0 0 4.5 2.63c2.17-3.38 6.4-8.9 4.52-13.12-2-4.64-8.5-8.28-12.77-10.4a2.13 2.13 0 0 0-2.14 3.67 95.51 95.51 0 0 1 11.91 9.3l1.48-3.6c-18.05.37-37.27 3-49 18.24-1 1.35 1.28 3.15 2.37 1.84z" class="R"/><path d="M329.25 123.9c-4.1-19.22-15.34-34.07-30.14-46.5-1.95-1.64-5.53-.7-5.4 2.24l.7 17H301q-.4-3.6-.83-7.18c-.23-1.85 0-6.7-1-8.08.1-1.14-.15-1.2-.75-.2-1 .67-.85 1 .34.83.67.5 3.05.4 3.9.5 2.93.38 5.84.9 8.8 1 3.58.1 4.4-5.47.85-6.28a116.06 116.06 0 0 0-12.58-1.77c-2.32-.28-4.7-.63-6.38 1.42s-.8 4.9-.53 7.18l1.54 12.57c.54 4.2 6.87 4.35 6.62 0l-1-17-4.77 2.73c15.83 8.44 26.28 25.45 30.32 42.55.57 2.38 4.17 1.37 3.66-1z" class="Q"/><path d="M841.5 140.3a125.16 125.16 0 0 0 2-34.66 2.74 2.74 0 0 0-5.06-1.37 61.58 61.58 0 0 1-7.35 9.22l4.84 2.8c.62-1.88 1.56-5.78 3.23-7 1.84-1.37 4.26 1.72 5.85 3.1 3.6 3.1 8-2.6 4-5.14-2.86-1.8-7.86-7.27-11.44-5s-6 8.5-7.2 12.5c-.82 2.72 2.88 5 4.83 2.82a68.74 68.74 0 0 0 7.92-10.59l-5-.65A158.45 158.45 0 0 1 839.3 140a1.13 1.13 0 0 0 2.21.3z" class="P"/><g class="G H L M N"><text transform="translate(301.98 310.7)">WZB1</text></g><g class="G H L M N"><text transform="translate(575.65 310.91)">WZA2</text></g><g class="G I L M N"><text transform="translate(591.63 978.22)">TteUvrD</text></g><g class="G I L M N"><text transform="translate(106.56 894.22)">BstPol</text></g><g class="G I L M N"><text transform="translate(717.84 175.42)">StrepII Tag</text></g><g class="G I L M N"><text transform="translate(0 115.26)">10xHis Tag</text></g><g class="G I L M N"><text transform="translate(204.59 157.9)">MBP Tag</text></g><g class="G J L M N"><text transform="matrix(.99 -.14 .14 .99 296.78 504.69)">L1</text></g><g class="G K L M"><text transform="matrix(.82 .57 -.57 .82 666.22 544.29)" font-size="35.95">L1</text></g></svg>
+				<svg style="height:100%" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 903.96 987.62"><style>.G,.H,.I,.j,.k,.l,.m,.J,.K,.p{isolation:isolate}.H{letter-spacing:-0.01em}.J{letter-spacing:-0.04em}.K{letter-spacing:-0.04em}.L{font-family:montserrat-light,sans-serif}.M{font-weight:300}.N{font-size:36px}.O{stroke-miterlimit:10}.P{fill:#ffd762}.Q{fill:#6281ef}.R{fill:#2e64ec}></style><g stroke="#ffc43b" stroke-width="3.78" class="O P"><path d="M86.06 693.34c4.22-9.4 11.1-18.23 20.7-22.06 11.3-4.5 24-1.36 35.4 2.77s22.8 9.3 34.92 8.8 25.08-9.14 25.36-21.2c.18-7.37-4.27-14.06-5.1-21.37-1.17-10.13 4.93-20.1 13.2-26.23s18.4-9 28.4-11.42c12.4-3 29.07-3.17 33.66 8.6 1.57 4 1.15 8.53.7 12.85-2.26 22.08-5.64 46.4-22.47 61.07-17 14.84-44.85 16.7-56.24 36.17-8.17 14-4.25 31.85 3.1 46.12 2.4 4.66 5.23 9.67 4.18 14.83-.7 3.37-2.93 6.2-5.1 8.86-4.9 6-12.75 12.7-19.37 8.73-2.22-1.33-3.66-3.64-5.65-5.3-4.92-4.1-13.3-3.15-17.23 2s-2.66 13.4 2.65 17c6.35.45 8.42-10.22 14.75-11.07 2.56-.34 5 1.1 7.36 2 11 4.25 24.12-3.27 29.36-13.93s4.26-23.28 1.37-34.72c-2.4-9.5-6-19.4-3.26-28.85 3.52-12 15.86-18.78 26.45-25.54 27.35-17.5 50.45-45.8 51.16-78 .22-9.86-1.95-20.28-8.67-27.47-13.8-14.73-38.1-9.34-57.4-2.8-17.64 6-38.56 16.18-39.15 34.7-.23 7.16 2.9 13.9 4.42 20.9s.94 15.43-4.82 19.77c-5.2 3.93-12.44 3-18.82 1.83l-44.8-8c-8.2-1.47-16.77-2.92-24.75-.43-14.62 4.58-22.24 20.56-26 35.35-5.1 20-6.2 41.77 1.92 60.62s27.07 33.88 47.74 33c19.22-.84.43-11.62-3-14-9.18-6.5-16.2-13.08-21.7-23.24-9.8-18.26-11.84-41.1-3.23-60.3z"/><path d="M153.33 679.33c-2.12 1.93-3.86 4.24-6.33 5.8-10 6.36-29.5-3.68-35.34-16.8s.26-25.92 11.46-30.82 26.22-3.18 40.43 1.25c9.15 2.86 19.93 6.68 25.87 2 11.35-8.9-10.52-32.4-5.46-46 3.06-8.26 14.85-9.3 25.4-7.66 9 1.4 18.67 4.35 26.47 10.56 16.26 12.92 17.94 33.4 17.76 50.23-.14 13.2-.34 26.67-5.44 37.75s-16.14 19.5-30.7 18.26c-12.42-1.07-26.3-8.9-37.4-6.4-9.5 2.13-13.78 11.93-11.47 22s10.2 19.88 19.54 27.18c11.3 8.84 26.9 14.52 36.75 9.44 8.47-4.37 12.3-16 23.45-14.35 6.72 1 13.08 6.94 16.5 13.05 8 14.3 2.75 29.8-9.58 35.44s-29.88 2.63-45.16-5.13-28.58-19.73-40.25-32.36c-10.6-11.46-20.44-23.92-33.4-32.92S106 706.3 96.55 713.5c-2.64 2-4.54 5.14-3.68 8.87 1.62 7 12.2 11.63 18.6 9.73s9.56-7.8 12.32-13.36c25.2 12.8 32.2 43.88 52.48 63.84 21.63 21.25 53.75 25.46 79.2 22.17 14.18-1.84 28.75-6.32 33.13-18.43 5.07-14-6.07-33.57-21.37-45.92-5.8-4.68-12.4-8.73-19.2-10.34-9.78-2.32-18.4.67-26.32 3.72s-16.37 6.2-26.14 4.2-20.7-11.46-19.87-19.93c.62-6.34 7.42-9.38 14.45-9.38s14.5 2.27 21.76 3.27c24.4 3.4 44.86-8.45 53.5-26.75s6.6-42.1-1.55-65c-4.57-12.8-11.64-26.32-23.7-35.5-16.83-12.8-38.72-13.3-53.94-6.7-10.56 4.56-19.54 14-15.9 26.4 1.6 5.5 5.52 10.85 7.23 16.36s0 11.9-5.74 11.74c-2.56-.07-5.24-1.43-7.82-2.6-32.5-14.85-68.34-1.9-72.8 26.33-1.1 7-.3 15.25 4.9 22.35 4.6 6.28 12 10.7 19.26 13.4 13.74 5.1 28.1 4.82 38.38-.76 5.4-2.93 25.48-5.73 25-12.72-.84-12.06-21.75-2.5-25.42.83z"/><path d="M313.7 681.17c-.77 8.8-9.87 15.42-18.7 15.06s-16.7-6.46-21-14.16c-3.54-6.3-5-13.55-8.25-20-8.7-17.44-28.17-26.23-46.17-33.7-9.5-4-20.82-7.78-29.53-2.33-6.82 4.27-9.66 13-16.14 17.73-5.94 4.36-13.9 4.67-21.23 3.87a87.31 87.31 0 0 1-50-23.09c-2.7-2.54-5.28-5.3-8.6-6.93-10.33-5.08-23.86 4.76-24 16.27s10.86 21.26 22.35 21.9c8 .45 15.8-2.66 23.83-3 11.75-.45 22.75 5.05 34.05 8.2s25.1 3.38 32.94-5.37c2.6-2.9 4.3-6.56 7.13-9.22 7.3-6.85 19.3-4.76 28 .2 12.8 7.26 22.13 19.22 31 30.9s18.1 23.72 30.74 31.27 29.7 9.6 41.66 1c12.15-8.73 15.46-26.54 10-40.47s-18.13-24.07-32-29.75c-8.76-3.6-21.22-4.36-25.37 4.16-2.82 5.78.27 13 5.32 17 9.8 7.76 35.58 2 33.97 20.45z"/><path d="M224.75 549.3c-7.08-2.62-14.2-3-26.14-4.7-5.66-.8-12.32 2-16.38 6-2.7 2.7-2.5 7.08-1.87 10.84a83.64 83.64 0 0 0 16.79 37.7c4.74 6 10.65 12.22 10.34 19.85-.4 9.7-10.7 16.38-12.45 25.92-2.33 12.66 10.53 22.3 21.27 29.4 11.46 7.6 22.58 16.32 29.9 28s10.27 26.7 4.8 39.35c-6.3 14.5-23.93 23-39.17 18.84-10.76-2.92-19.3-11-29.22-16s-23.86-6.27-30.65 2.58-2.28 21.46 1.7 31.9c3.5 9.17 23.53 70.57-2.4 56.64-22.92-12.3-20.86-64.2-23.25-84.85-.28-2.4-.55-4.9.2-7.2 1.1-3.28 4-5.54 6.8-7.57 10.8-7.88 22.16-15.8 35.3-18.26s28.56 2.15 34.65 14c1.93 3.78 2.95 8.2 6.1 11.06 4.6 4.16 12.4 3 16.86-1.33s6-10.93 5.83-17.14a39.52 39.52 0 0 0-15.54-30.18c-9-6.75-20.5-9.35-29.68-15.8a43 43 0 0 1-17.32-41.3c1.55-9.32 6.22-18 6.77-27.47.88-14.9-8.5-28.2-17.25-40.28-2.87-4-5.83-8.25-6.1-13.14-.43-8 6.36-14.42 13.32-18.28 15.93-8.86 39.5-4.2 59.12-.34"/><path d="M161.88 628c-.5 4.1-1.73 8.14-1.55 12.27a23.17 23.17 0 0 0 4.67 12.49c8.26 11.36 24.75 15.85 37.63 10.25 4.35-1.9 8.3-4.8 13-5.77 9.9-2.1 19.18 4.93 26.87 11.5 4.16 3.56 8.5 7.38 10.32 12.55 4.06 11.63-6.17 24.8-1.8 36.32 4 10.52 17.3 13.22 28.45 14.9s24.5 6.12 26.38 17.22c.83 4.83-.9 9.72-2.85 14.23-4.13 9.6-9.8 19.25-19.1 24-11.17 5.7-24.55 3-36.92.92s-26.57-2.8-35.88 5.6c-6.46 5.84-9 14.85-14.55 21.6-10.83 13.2-30.18 15-47.25 14.26-8.7-.36-18.32-1.54-24.13-8.05-3.27-3.67-4.83-8.56-5.74-13.4A64.77 64.77 0 0 1 124.7 769c3.92-8.1 9.55-15.4 12.43-23.93A40.4 40.4 0 0 0 102 691.85c-2.74-.22-6.17.3-7.1 2.88-.6 1.72.22 3.6 1.07 5.22 3.85 7.38 8.4 14.5 10.68 22.52a42.79 42.79 0 0 1-44.86 54.36c-5.48-.48-11.12-2.18-15-6.14s-5.25-10.56-2.14-15.1c2.37-3.45 6.75-5 10.94-5.2 12.6-.5 26.2 9.47 36.8 2.63 9.65-6.2 7.74-20.93 2.77-31.27s-12-21.3-9-32.36c3.2-11.56 17.16-17.6 29-15.35s21.45 10.7 29.08 20c7.14 8.7 13.15 18.6 15.64 29.56s1.17 23.13-5.27 32.35c-7.57 10.85-21.9 17.9-23.66 31a22.57 22.57 0 0 0 3.23 14.27 28.38 28.38 0 0 0 47.85 1.78c7.5-10.86 7.44-26.77 18-34.75 9.9-7.5 23.88-4.1 35.77-.57s26.18 6.32 35.5-1.82c2.23-1.94 4.06-4.65 3.94-7.6-.13-3.15-2.42-5.78-4.85-7.8-8.2-6.8-18.86-9.62-28.38-14.38s-18.77-13-19.07-23.62c-.28-10 7.36-20.54 2.4-29.22-3.87-6.77-13.37-7.82-20.94-6s-14.7 5.82-22.5 6.18c-14.87.68-27.12-11.84-34.07-25-1.85-3.52-3.52-7.26-3.76-11.23s1.06-8.12 1.8-12.16c2.08-11.3-1.1-24.47-10.86-30.53s-25.68-.3-26.3 11.17c-.54 9.92 9.36 17.7 10.3 27.58.88 9.5-8.56 18.5-18 17.2-5.8-.8-10.7-4.7-16.38-6.14-10.46-2.64-22.36 5-24.3 15.6-1.5 8.23.45 19.85-7.57 22.25a27.3 27.3 0 0 1 22.05-45.57c6.9.46 13.42 3.52 20.32 3.84s15-3.73 15.26-10.63c.2-5.23-4.1-9.36-6.8-13.84a25.58 25.58 0 0 1 0-25.89c18.4-30.5 61.87-.9 58.3 27.92z"/></g><g stroke="#4675eb" stroke-width="4" class="Q O"><path d="M572.33 782.9c4.22-9.42 11.1-18.24 20.7-22.07 11.3-4.5 24-1.36 35.4 2.77s22.8 9.3 34.92 8.8 25.08-9.14 25.36-21.2c.18-7.37-4.27-14.05-5.1-21.37-1.17-10.13 4.93-20.1 13.2-26.23s18.4-9 28.4-11.42c12.4-2.95 29.07-3.17 33.65 8.6 1.57 4 1.16 8.54.7 12.85-2.25 22.08-5.63 46.4-22.46 61.07-17 14.85-44.85 16.7-56.25 36.17-8.16 14-4.24 31.85 3.1 46.12 2.4 4.66 5.23 9.67 4.18 14.84-.7 3.36-2.93 6.18-5.1 8.85-4.9 6-12.75 12.7-19.36 8.73-2.23-1.33-3.66-3.63-5.65-5.3-4.92-4.1-13.3-3.15-17.24 2s-2.65 13.4 2.65 17c6.36.44 8.43-10.23 14.76-11.07 2.56-.35 5 1.1 7.36 2 11 4.25 24.12-3.26 29.35-13.93s4.27-23.28 1.38-34.72c-2.4-9.5-6-19.4-3.26-28.85 3.52-12 15.86-18.77 26.44-25.54 27.36-17.5 50.46-45.8 51.17-78 .22-9.87-2-20.3-8.68-27.48-13.8-14.73-38.1-9.34-57.4-2.8-17.64 6-38.56 16.2-39.16 34.7-.23 7.16 2.9 13.92 4.42 20.9s.94 15.43-4.8 19.77c-5.2 3.93-12.44 3-18.83 1.83l-44.8-8c-8.2-1.47-16.77-2.92-24.74-.43C562 756 554.37 772 550.6 786.8c-5.1 20-6.2 41.77 1.93 60.62s27.07 33.88 47.74 33c19.2-.83.43-11.62-3-14-9.18-6.5-16.2-13.1-21.72-23.25-9.8-18.16-11.83-41.04-3.2-60.25z"/><path d="M647.08 816.16c1.7 3.15 3.8 6.1 5.08 9.43 5.2 13.5-7.26 28.33-21.15 27.67s-26-13.42-29.62-27.37 0-28.46 6.14-40.76c4-7.92 9.12-17 5.15-25.46-7.6-16.14-33.86-5.66-46.95-17.75-7.94-7.33-7.56-19.92-4.64-29.88 2.5-8.54 6.63-16.9 13.82-21.75 15-10.1 35.76-1.43 52.68 7.3 13.25 6.83 26.78 13.88 37.32 24.72s17.67 26.42 14.66 40.68c-2.57 12.17-12.1 22.42-10.94 35 1 10.8 10.34 20.16 20.7 22.88s21.23-.34 29.7-6.2c10.25-7.1 17.85-20.17 13.92-32.84-3.37-10.9-14.6-20.7-11.6-31.3 1.8-6.38 8.55-9.87 15.12-10.3 15.35-1 30.3 12.3 34.5 27.8s-1 31.93-10.62 43.63S737.07 831 723 836.52c-12.82 5-26.54 8.78-37.16 17.48s-17.33 24.28-11.22 37.6c1.7 3.73 4.62 7.27 8.48 8.28 7.26 1.9 13.18-6.58 12-14.12s-6.7-13.74-12-19.4c15.94-19.25 48.06-10.65 70.6-21.33 24-11.37 32.1-42.12 31.86-69.85-.13-15.45-2.9-32.65-14.53-43.27-13.48-12.3-34.5-10.82-48.78-1.42-5.4 3.56-10.28 8.27-12.73 14.4-3.5 8.84-1.54 19.18.57 28.84s4.28 19.9 1.1 28.9-14 15.4-22.45 10.24c-6.3-3.86-8.53-12.36-7.7-19.55s4-13.7 5.92-20.62c6.35-23.26-3.1-50.2-20.46-68.34S625 676.27 601 673c-13.44-1.82-27.88-1.43-38.56 6.25-14.92 10.73-18.05 32.9-13.27 51.82 3.32 13.13 11.7 27.1 24.65 29.68 5.74 1.15 11.58-.14 17.33.9s12 6 11.1 11.83c-.37 2.58-2.07 4.64-3.56 6.7-18.87 25.75-10.15 69 17.7 87.9 6.93 4.7 15.3 8 23.07 6.3 6.88-1.53 12.22-6.85 15.8-12.92 6.8-11.47 8.24-26.33 3.87-39.67-2.3-7-2.7-29-9.78-32-12.28-5.32-5.17 21-2.3 26.38z"/><path d="M576.94 746c1.56-7.43 9.74-11.6 17-9.83s13 8.33 15.8 15.66c2.24 6 2.7 12.47 4.66 18.56 5.3 16.43 20.37 27.2 34.37 36.62 7.4 5 16.28 10.14 24 6.9 6-2.53 9.3-9.54 15.14-12.55 5.34-2.76 11.92-1.7 17.86.2a78.75 78.75 0 0 1 38.63 28.13c1.94 2.63 3.78 5.43 6.34 7.38 7.95 6.08 20.1-.12 21.42-10s-6.66-20.06-16-22.52c-6.54-1.7-13.28-.33-19.9-1.4-9.7-1.56-18.16-8.12-27.1-12.73s-20.28-7.08-27.65-.86c-2.44 2.06-4.22 4.92-6.83 6.74-6.72 4.67-16.36.88-23-4.8-9.74-8.36-16.15-20.18-22.24-31.7s-12.37-23.4-21.95-32S584 714.62 573.3 720c-10.9 5.5-15.53 20.24-12.5 33.1s12.35 23.7 23.12 30.9c6.82 4.55 17 7.26 21.3.63 2.92-4.5 1.16-11.24-2.57-15.5-7.22-8.23-29-7.57-25.72-23.14z"/><path d="M714.5 653.63c3.7 5.43 9.62 14.57 13.63 24.54 1.9 4.74 1.1 11.43-1.3 16.2-1.6 3.18-5.2 4.32-8.4 4.88a63.36 63.36 0 0 1-34.43-3.49c-5.94-2.38-12.32-5.7-18.47-3.15-7.8 3.24-11 14.27-18.35 18.67-9.8 5.83-20.5-2.6-28.68-9.9-8.73-7.8-18.3-15-29.42-17.9S565 682.5 556 691c-10.4 9.85-13.4 27.87-6.64 40 4.77 8.57 13.2 13.66 19.55 20.86s10.4 19.1 4.72 27.7-17 8.4-26.37 8c-8.25-.33-62.7.4-45.6 19 15.12 16.45 56.94-.85 74.3-4.92a14.22 14.22 0 0 0 5.83-2.35c2.42-1.93 3.6-5.18 4.65-8.23 4-11.83 8-24.18 7-36.45s-8.1-24.43-19.14-26.23c-3.5-.57-7.35-.14-10.36-2-4.42-2.8-5.2-10-2.66-15.2s7.57-8.52 12.66-10.24a30 30 0 0 1 28 4.63c7.5 5.88 12.17 15.2 19.47 21.35 10.24 8.6 25.43 9.77 37.5 2.86 7.25-4.14 13.3-10.85 20.86-14.15 11.94-5.2 24.87-1 36.66 3.12 3.87 1.34 8 2.67 12 1.43 6.57-2 10.33-9.9 11.94-17.16 3.67-16.63-6.3-36.38-15.5-49.28"/><path d="M573.26 765.23c3.4 1.85 6.6 4.35 10.2 5.57a18.87 18.87 0 0 0 11.95-.21c11.9-3.9 20-17.78 18.4-31.7-.52-4.7-2-9.38-1.68-14 .7-9.94 9.12-16.25 16.75-21.22 4.14-2.7 8.53-5.47 13.46-5.42 11.06.1 19.83 14.1 30.88 13.9 10.1-.2 15.8-11.72 20.1-21.55s11.5-20.8 21.56-18.85c4.4.86 8.16 4.12 11.56 7.45 7.23 7.08 14.12 15.63 15.86 25.9 2.08 12.35-3.68 23.93-8.6 34.8s-9.17 23.87-4.3 35.4c3.4 8 10.52 13.43 14.93 20.86 8.65 14.55 5.26 33.22.3 48.92-2.53 8-6 16.6-13.08 19.83-4 1.82-8.62 1.63-13 .86a60.37 60.37 0 0 1-33.06-18.35c-6-6.38-10.87-14.1-17.5-19.65-9-7.57-21-10.46-31.54-7.6s-19.4 11.4-23.34 22.5c-.88 2.5-1.32 5.85.7 7.58 1.33 1.16 3.16 1 4.77.76 7.35-1.1 14.67-3 22.16-2.4 12.4.93 24.6 8.93 31.55 20.72s8.48 27 3.94 39.47c-1.8 5-4.7 9.66-9.1 11.9s-10.45 1.35-13.58-3.08c-2.38-3.37-2.63-8-1.7-12 2.78-12 14.84-21.3 11.64-33.5-2.9-11.1-16.1-14.27-26.3-13.1s-21.44 4.08-30.2-2.5c-9.17-6.9-10.82-21.94-5.9-32.2s14.7-16.44 24.63-20.44c9.3-3.75 19.38-6 29.48-4.67a38.58 38.58 0 0 1 26.58 15.8c7.43 10.72 9.88 26.46 20.74 32.52a18.92 18.92 0 0 0 13.14 1.79c8.28-1.74 15.3-8.45 18-17.2a32 32 0 0 0-4.35-26.9c-7.47-10.66-21.2-16-25.42-28.47-3.95-11.75 2.54-23.68 8.6-33.6s12.17-22.3 7.5-33.78c-1.1-2.73-3-5.35-5.56-6.23-2.75-.94-5.6.32-8 1.9-7.94 5.36-13.1 14.38-19.62 21.67s-16 13.16-25.23 9.86c-8.7-3.1-15.86-13.78-24.6-12.07-6.82 1.34-10.14 9.85-10.45 17.55s1.28 15.7-.4 23.1C623 779.27 609.1 786.5 596 788.57c-3.5.55-7.16.85-10.65-.27s-6.74-3.72-10-5.78c-9.2-5.74-21.4-7.2-29.1-.13s-6.78 23.9 3 28.33c8.42 3.85 17.64-2.8 26.4-.33 8.42 2.37 13.8 14.22 10.27 22.6-2.17 5.14-6.78 8.4-9.46 13.23-4.94 8.88-1.38 22.56 7.3 28 6.72 4.18 17.25 6.25 17.28 14.55-8.75 4.08-20 1.56-27.2-6.1s-9.9-20-6.53-29.8c2.15-6.28 6.44-11.35 8.47-17.7s.6-15.26-5.3-17.82c-4.46-1.94-9.12.66-13.67 1.7-7.9 1.77-16.83-1.7-22.34-8.7-21.8-27.53 14.8-58.16 38.77-45.1z"/></g><path d="M626.08 567.14c-1.4 1.17-2.87 2.48-3.17 4.27-.4 2.33 1.35 4.43 3 6.15l23.63 25.17c2.84 3 6.6 6.32 10.58 5.15a11.41 11.41 0 0 0 4.25-2.86l19.9-18.33a7.37 7.37 0 0 0 2.07-2.6c1.27-3.34-2.53-6.26-5.7-8-10.24-5.47-19.65-17-29.8-21.27s-16.48 5.38-24.75 12.32z" class="R"/><path d="M628.47 554.33c8.73 9.67 16.65 20.1 25 30.12l24.82 29.08c9.17 10.2 18.35 19.9 26.4 31.06 7 9.7 15.52 19.4 20.28 30.44 2.62 6.06 13 1.72 10.74-4.52-2.2-6-4.28-11.87-7.42-17.47s-7.23-10.63-11.08-15.77c-8.68-11.58-18.25-21.8-28.14-32.34-9.06-9.65-17.48-19.88-26.62-29.46a156.68 156.68 0 0 0-30.79-25.27c-2.6-1.62-5.12 2-3.18 4.13z" class="Q"/><path d="M477.34 342.77l5.1.37a26.53 26.53 0 0 0 5.17.67 3.45 3.45 0 0 0 .91-6.75c-3.53-1.18-8.3-.22-11.9.3-3.16.46-2.24 5.3.73 5.4zm-3.66 24.53c3.63.83 7.45.7 11.16.9a58.15 58.15 0 0 0 11.65-.12c4.75-.7 3-7.3-1.05-7.74-7-.78-14 1.65-20.93.83-3.5-.4-4.23 5.37-.83 6.14zm5.16 21.5l18 2.48c5.2.67 5.27-7.7 0-8.25a86 86 0 0 0-18 .15 2.81 2.81 0 1 0 0 5.62zm6.82 22.2l6.68-.6c2.23-.18 4.32.17 6.47-.22 3.25-.58 2.3-5.4-.74-5.52-2.08-.1-4.12.6-6.2.68l-6.2.28c-3.47.16-3.4 5.68 0 5.37zm-12.12-197.6h1s1 .1.5 0a15.09 15.09 0 0 1 2 .41 3.49 3.49 0 0 0 2.08-6.66A3.27 3.27 0 0 0 478 207a21.31 21.31 0 0 0-5.22.5 3 3 0 0 0 .8 5.89zm-1.1 24.66c3.16-.5 6.2.24 9.3.5a4.22 4.22 0 0 0 4.18-3.68 4.32 4.32 0 0 0-3.05-4.67c-4.27-1.47-9.13-.23-13 1.78a3.3 3.3 0 0 0-1.36 4.14 3.4 3.4 0 0 0 3.91 1.92zm4.43 24.64c.75-.14-.58-.05.1 0h.5c-.64-.17.2.07.34.1a4.06 4.06 0 0 0 1.2.18c-.66-.1-.77-.1-.33 0a4.14 4.14 0 0 0 5.065-2.935 4.14 4.14 0 0 0-2.935-5.065 4 4 0 0 0-1-.14 8.41 8.41 0 0 0-6 2.53 3.24 3.24 0 0 0-.5 3.86 3.36 3.36 0 0 0 3.6 1.47z" class="R"/><path d="M226.34 551.3a315.57 315.57 0 0 0 105.71-8.83c34.85-9 67.35-24.6 98.73-42 26.1-14.46 53.5-29.86 71.07-54.77 19.87-28.15 17.56-63.26 6.9-94.52-11.12-32.63-30.18-62.43-38.06-96.18a114.65 114.65 0 0 1 12-82.06c14-25 36.16-44.84 63.48-54 16.9-5.7 34.7-8 52.34-9.9 15.87-1.73 31.74-3.42 47.7-4.28 28-1.5 55.8.82 83.8 1.57 25 .67 51.46 1.2 75.73-5.6a61.33 61.33 0 0 0 14.2-5.73c8.14-4.7.8-17.35-7.38-12.62-9.14 5.3-19.87 7.37-30.2 9a306.88 306.88 0 0 1-38.9 3c-27 .67-54-1.8-81-.8-14.52.54-29 1.88-43.43 3.33-17.28 1.74-34.7 3.33-51.78 6.52-29.8 5.57-57.07 18.07-77.52 40.9a131 131 0 0 0-32.72 74.4c-3.1 32.18 9 62.25 22.06 91 13.67 30.17 29.7 63.54 23.48 97.65-5.6 30.77-29 50.8-54.43 66.4-29 17.8-59.83 34.58-92.05 45.66a315.8 315.8 0 0 1-103.18 17.06c-8.86 0-17.7-.44-26.54-1.2-10.25-.88-10.2 15.13 0 16z" class="P"/><path d="M712.7 635.35a604 604 0 0 0-111.83-118.41c-24.92-20.12-50.54-39.37-75.7-59.17-11.8-9.28-23.56-19-32.8-30.95a107 107 0 0 1-18.67-38.09c-7.88-29.6-.32-57.8 9-86.05 4.66-14.1 9.38-28.28 11.7-43a132.07 132.07 0 0 0-.71-44.48c-5.45-29.84-19.62-57.4-33.78-83.93-6.83-12.78-13.86-25.5-22.22-37.38s-18-21.77-28.42-31.7c-7.2-6.88-14.55-13.53-23.25-18.55-8-4.6-16.62-8.16-25-12-15.1-6.88-30.35-10.3-46.8-12.33a107.6 107.6 0 0 0-21.82-.89c-5.86.44-7.86 9.3-1.46 10.8 19.08 4.45 38.84 3.7 57.43 10.68 15.1 5.67 32.25 12.53 45 23.42 9.4 8 18.85 16.47 27 25.8 9.6 11 17.44 23.4 24.77 36 15.12 26 29.94 52.9 37.42 82.2a127.35 127.35 0 0 1 3.73 45.12c-1.58 14.65-6.06 28.87-10.6 42.83-9 27.77-18 55.13-13.52 84.7 4.28 28.16 19.14 52.5 40.08 71.44 11.44 10.34 23.9 19.55 36 29q19.3 15.1 38.66 30.1c43.48 33.75 83.24 71.85 119.66 113.13 4.22 4.8 8.27 9.73 12.24 14.72 1.75 2.2 5.58-.7 3.93-3z" class="Q"/><path d="M295.3 554.46c.07 3.4 0 6.86 1.2 10s3.77 6.1 7.13 6.5a13.49 13.49 0 0 0 4.29-.4l31.4-6.3c5.55-1.12 12.1-3.13 13.6-8.6.73-2.73-.08-5.6-.88-8.3L343.6 519c-.57-1.92-1.37-4.1-3.25-4.8a6.68 6.68 0 0 0-2.88-.18c-11.9 1-27.9 1.07-38.55 7.2-10.84 6.3-3.84 21.98-3.62 33.24z" fill="#ffc43b"/><path d="M263.38 8.4c-4-2.9-8-6-12.64-7.54S240.37-.3 236.88 3.18c-1.25 1.25-2.16 2.8-3.45 4C229 11.3 222 10 216.38 12.08c-5.78 2.18-9.6 8-11 14s-.94 12.28-.4 18.43c.3 3.6.66 7.32 2.45 10.46s5.43 5.52 8.94 4.67c1.92-.47 3.6-1.84 5.58-1.93 3.86-.16 6.12 4.56 5.85 8.4s-2 7.6-1.5 11.45c1 7.9 10.55 11.86 18.5 11.16s15.46-4.32 23.42-4.63c2.83-.1 5.8.17 8.35-1a14.26 14.26 0 0 0 4.86-4.34c4.38-5.5 8.15-12.4 6.7-19.27-.52-2.46-1.68-4.76-2-7.25-.7-5.4 2.74-10.68 7.3-13.66s12.08-6.46 17.45-7.38c.78-.13-8.68-6.64-9.46-7.2-3.93-2.92-8.1-3.78-12.77-4.63A57.38 57.38 0 0 1 263.38 8.4z" class="Q"/><path d="M807.05 98.3c-4.07.9-8.2 1.83-12.36 1.44s-8.38-2.3-10.5-5.9c-2.5-4.24-1.55-9.58-.83-14.46s.87-10.54-2.66-14a10.14 10.14 0 0 1-2.25-2.37 5.21 5.21 0 0 1 .35-4.28c3.14-7.12 12.3-10.9 19.56-8 1.7.66 3.35 1.65 5.17 1.6 2.68-.08 4.7-2.34 6.74-4.07A18 18 0 0 1 824 43.85a14.13 14.13 0 0 1 11.28 8.47c.76 1.93 1.06 4.1 2.4 5.7 2.9 3.47 8.63 2.2 12.56 4.45 5.16 2.94 5 11 1.22 15.57s-9.75 6.57-15.4 8.42S826.5 91 821.62 94c-4.34 2.63-9.62 3.18-14.57 4.3z" class="P"/><path d="M198.82 58c-4.25 3-10.62 5.08-14.28 1.37-1-1-1.68-2.32-3-2.76-1.77-.6-3.53.73-5.13 1.7-5.93 3.55-13.92 2.12-19.4-2.08s-8.78-10.7-10.8-17.3c-.7-2.25-1.26-4.66-.7-7 1-4 5.2-6.56 9.32-7.1s8.26.43 12.38.95 8.6.48 12.08-1.78c2.82-1.83 4.68-5 7.66-6.5 3.8-2 8.7-.93 12.1 1.73s5.5 6.62 7.06 10.64c5 12.9 4.34 19.85-7.27 28.15z" class="R"/><path d="M449.7 170.3a116.43 116.43 0 0 0-33.2-2.43 2.52 2.52 0 0 0-2.47 2.57 2.8 2.8 0 0 0 .08.57 986.85 986.85 0 0 1 12.07 106.8c2 33.62 1.16 67.67 7.5 100.87 3.53 18.47 13 37.6 10.37 56.7-.22 1.65.37 3.87 2.37 4.17l23.3 3.47c3.74.48 4.64-6 .9-6.63-7.44-1.28-14.93-2.27-22.4-3.37l2.5 3.27c2.16-16.67-4.32-32.34-8.4-48.18-4.44-17.24-6.46-35-7.65-52.7-2.38-35.6-3.08-71.13-7.2-106.6q-3.42-29.67-8.58-59.1l-2.4 3.14a189.07 189.07 0 0 1 32.7 1.13c2.1.23 2.52-3.2.5-3.66z" class="P"/><path d="M505.56 173.1l28.32 4.62c2.5.36 4.55.14 6.3 2s1.56 5.05 1.82 7.66q.8 7.8 1.55 15.58l5 57.6c2.6 38.6 3.1 77.55-1.5 116-2.6 21.72-7.5 43.22-7.2 65.2l3.76-3.77-22.66-.32c-4.72 0-4.68 7.1 0 7.32 7.55.34 15.1.42 22.66.53a3.81 3.81 0 0 0 3.76-3.76c-.45-20.67 3.84-40.9 6.36-61.32a485 485 0 0 0 3.47-61.31c-.15-41.5-4.43-82.84-9.35-124-.6-5.1-.8-10.45-1.82-15.48-.65-3.23-2.3-5.33-5.55-6.24-10.7-3-22.63-3.43-33.6-5-3-.42-4.33 4.1-1.27 4.6zM83.43 71.1c11.48-13.76 29.88-15.5 46.65-15.9a2.11 2.11 0 0 0 1.48-3.57 133.28 133.28 0 0 0-12.73-10l-2.14 3.67c3.16 1.7 7.4 4 9.33 7.06 2.1 3.33-1.9 7.15-3.44 10.17a2.61 2.61 0 0 0 4.5 2.63c2.17-3.38 6.4-8.9 4.52-13.12-2-4.64-8.5-8.28-12.77-10.4a2.13 2.13 0 0 0-2.14 3.67 95.51 95.51 0 0 1 11.91 9.3l1.48-3.6c-18.05.37-37.27 3-49 18.24-1 1.35 1.28 3.15 2.37 1.84z" class="R"/><path d="M329.25 123.9c-4.1-19.22-15.34-34.07-30.14-46.5-1.95-1.64-5.53-.7-5.4 2.24l.7 17H301q-.4-3.6-.83-7.18c-.23-1.85 0-6.7-1-8.08.1-1.14-.15-1.2-.75-.2-1 .67-.85 1 .34.83.67.5 3.05.4 3.9.5 2.93.38 5.84.9 8.8 1 3.58.1 4.4-5.47.85-6.28a116.06 116.06 0 0 0-12.58-1.77c-2.32-.28-4.7-.63-6.38 1.42s-.8 4.9-.53 7.18l1.54 12.57c.54 4.2 6.87 4.35 6.62 0l-1-17-4.77 2.73c15.83 8.44 26.28 25.45 30.32 42.55.57 2.38 4.17 1.37 3.66-1z" class="Q"/><path d="M841.5 140.3a125.16 125.16 0 0 0 2-34.66 2.74 2.74 0 0 0-5.06-1.37 61.58 61.58 0 0 1-7.35 9.22l4.84 2.8c.62-1.88 1.56-5.78 3.23-7 1.84-1.37 4.26 1.72 5.85 3.1 3.6 3.1 8-2.6 4-5.14-2.86-1.8-7.86-7.27-11.44-5s-6 8.5-7.2 12.5c-.82 2.72 2.88 5 4.83 2.82a68.74 68.74 0 0 0 7.92-10.59l-5-.65A158.45 158.45 0 0 1 839.3 140a1.13 1.13 0 0 0 2.21.3z" class="P"/><g class="G H L M N"><text transform="translate(301.98 310.7)">WZB1</text></g><g class="G H L M N"><text transform="translate(575.65 310.91)">WZA2</text></g><g class="G I L M N"><text transform="translate(591.63 978.22)">TteUvrD</text></g><g class="G I L M N"><text transform="translate(106.56 894.22)">BstPol</text></g><g class="G I L M N"><text transform="translate(717.84 175.42)">StrepII Tag</text></g><g class="G I L M N"><text transform="translate(0 115.26)">10xHis Tag</text></g><g class="G I L M N"><text transform="translate(204.59 157.9)">MBP Tag</text></g><g class="G J L M N"><text transform="matrix(.99 -.14 .14 .99 296.78 504.69)">L1</text></g><g class="G K L M"><text transform="matrix(.82 .57 -.57 .82 666.22 544.29)" font-size="35.95">L1</text></g></svg>
 			</div>
 			<div class="content">
 				<div class="h3">Helimerase</div>
 				<p>
-					However, regarding the WHO guidelines for point-of-care testing, our detection tool should not only be sensitive, specific and user-friendly but also it should be <b>affordable for target customers</b><sup>10</sup>. Keeping in mind that HDA amplification, performed using a commercial kit, is still too <b>expensive</b>, we have decided to search for new <b>alternatives</b> to reduce the cost of the test as much as possible.
+					However, regarding the WHO guidelines for point-of-care testing, our detection tool should not only be sensitive, specific and user-friendly but also it should be <b>affordable for target customers</b><a href="#citations" class="citation">10</a>. Keeping in mind that HDA amplification, performed using a commercial kit, is still too <b>expensive</b>, we have decided to search for new <b>alternatives</b> to reduce the cost of the test as much as possible.
 				</p>
 			</div>
@@ Line 181: / Line 191: @@
 			<div class="content noanim">
 				<p>
-					Our solution to this problem - <b>helimerase</b>. This protein complex contains <b>two</b> enzymes - <i>Thermoanaerobacter tengcongensis</i> <b>UvrD helicase</b> (<b class="semi">TteUvrD</b>) and <i>Bacillus stearothermophilus</i> <b>DNA polymerase I large fragment</b> (<b class="semi">BstPol</b>). TteUvrD is fused with one part of coiled-coil structure <b>WinZip-A2</b> (<b class="semi">WZA2</b>) via linker L1 and possesses a maltose-binding protein (<b class="semi">MBP</b>) and <b>10xHis Tag</b> in the N terminal end. BstPol is fused with the second coiled-coil part <b>WinZip-B1</b> (<b class="semi">WZB1</b>) through linker L1 and possesses <b>StrepII tag</b> in the N terminal end<sup>11</sup>. It was presumed that this non-covalent fusion strategy through coiled-coil structures should improve HDA reaction by letting to amplify longer DNA fragments as well as it allows to perform amplification reaction without using additional proteins such as MutL or others SSB proteins, which are used in such kind of reactions<sup>11,12</sup>.
+					Our solution to this problem - <b>helimerase</b>. This protein complex contains <b>two</b> enzymes - <i>Thermoanaerobacter tengcongensis</i> <b>UvrD helicase</b> (<b class="semi">TteUvrD</b>) and <i>Bacillus stearothermophilus</i> <b>DNA polymerase I large fragment</b> (<b class="semi">BstPol</b>). TteUvrD is fused with one part of coiled-coil structure <b>WinZip-A2</b> (<b class="semi">WZA2</b>) via linker L1 and possesses a maltose-binding protein (<b class="semi">MBP</b>) and <b>10xHis Tag</b> in the N terminal end. BstPol is fused with the second coiled-coil part <b>WinZip-B1</b> (<b class="semi">WZB1</b>) through linker L1 and possesses <b>StrepII tag</b> in the N terminal end<a href="#citations" class="citation">11</a>. It was presumed that this non-covalent fusion strategy through coiled-coil structures should improve HDA reaction by letting to amplify longer DNA fragments as well as it allows to perform amplification reaction without using additional proteins such as MutL or others SSB proteins, which are used in such kind of reactions<a href="#citations" class="citation">11,12</a>.
 				</p>
 			</div>
@@ Line 202: / Line 212: @@
 	<main>
 		<div id="animLfaResultsBlock" class="scrollBlock"></div>
-	</main>
-	<main>
-		<div class="scrollBlock noanim">
-			<div class="content noanim">
-				<p>
-					To make sure that the test is as convenient as possible, we collaborated with Micromolds to create a 3D model of the lateral flow assay test case. The created case has a specially designed well to add the liquid onto the sample pad and a window meant to observe the results. Also, this case ensures that the test strip with dried reagents is protected from the environment. The design of this test case was a crucial step for the future implementation of the test in aquaculture farms.
-				</p>
-			</div>
-		</div>
 	</main>
 	<div class="grandHeading">TREATMENT</div>
@@ Line 218: / Line 219: @@
 			<div class="content noanim">
 				<p>
-					After detection of an exact <i>Flavobacterium</i> species, farmers need to start an exact treatment process as soon as possible. Currently, fish infected with flavobacterial diseases are treated with <b>different types of antibiotics</b><sup>28</sup>. Scientific data shows<sup>35</sup> that the most abundant <b>antibiotic</b> used for salmon cultivation was quinolone, whose consumption (by mass) in 2007 <b>reached 821,997 tonnes</b>. And that is only in Norway! Other commonly used antibiotics in farms are oxolinic acid and florfenicol, whose consumption reached 681 kg in 2008 and 166 kg in 2010 respectively. This enormous usage of a broad range of antibiotics forces the evolving of <b>antibiotic-resistant</b> bacterial fish pathogens. It is quite evident that these numbers raise huge concerns and questions on how we can reduce the usage of antibiotics?
+					After detection of an exact <i>Flavobacterium</i> species, farmers need to start an exact treatment process as soon as possible. Currently, fish infected with flavobacterial diseases are treated with <b>different types of antibiotics</b><a href="#citations" class="citation">28</a>. Scientific data shows<a href="#citations" class="citation">35</a> that the most abundant <b>antibiotic</b> used for salmon cultivation was quinolone, whose consumption (by mass) in 2007 <b>reached 821,997 tonnes</b>. And that is only in Norway! Other commonly used antibiotics in farms are oxolinic acid and florfenicol, whose consumption reached 681 kg in 2008 and 166 kg in 2010 respectively. This enormous usage of a broad range of antibiotics forces the evolving of <b>antibiotic-resistant</b> bacterial fish pathogens. It is quite evident that these numbers raise huge concerns and questions on how we can reduce the usage of antibiotics?
 				</p>
 				<p>
-					Scientific data already shows that some <i>F. psychrophilum</i> isolates already have reduced susceptibility to quinolones, oxolinic acid, and enrofloxacin<sup>16</sup>. To reduce the amount of antibiotics used in aquaculture farms, our <b>second goal</b> is the development of two exogenous fish infection <b>treatment systems</b>, which are based on <b>quorum sensing mechanisms</b>. The treatment section fulfils our project main idea - <a href="#headingDetection">Detection</a> and offers an alternative way of fighting with pathogenic infections.
+					Scientific data already shows that some <i>F. psychrophilum</i> isolates already have reduced susceptibility to quinolones, oxolinic acid, and enrofloxacin<a href="#citations" class="citation">16</a>. To reduce the amount of antibiotics used in aquaculture farms, our <b>second goal</b> is the development of two exogenous fish infection <b>treatment systems</b>, which are based on <b>quorum sensing mechanisms</b>. The treatment section fulfils our project main idea - <a href="#headingDetection">Detection</a> and offers an alternative way of fighting with pathogenic infections.
 				</p>
 				<p>
-					Flavobacterial diseases occur when <i>Flavobacterium</i> forms a biofilm on fish fins or gills<sup>30</sup>. Our target bacteria - <i>Flavobacterium</i> uses signalling molecules for cell-cell communication. Quorum sensing is a bacterial communication process that leads to the regulation of genes and response to changes<sup>17–19</sup>. The quorum sensing has two distinguished systems - AHL and AI-2 for Gram-negative bacteria for now<sup>19–21</sup>. We used the circumstances to our advantage: build two genetic circuits that are enhanced by <b>quorum sensing signalling molecules</b>. Both synthetic biological systems are for <b>exolysin synthesis</b>, the difference is how transporter cell lyses itself. Thus, we are introducing three different strength AI-2 inducible promoters: a native <i>lsrACDBFG</i> (<a target="_blank" href="http://parts.igem.org/Part:BBa_K3416000">K3416000</a>) and two mutated ones EP01r (<a target="_blank" href="http://parts.igem.org/Part:BBa_K3416001">K3416001</a>) and EP14r (<a target="_blank" href="http://parts.igem.org/Part:BBa_K3416014">K3416014</a>).
+					Flavobacterial diseases occur when <i>Flavobacterium</i> forms a biofilm on fish fins or gills<a href="#citations" class="citation">30</a>. Our target bacteria - <i>Flavobacterium</i> uses signalling molecules for cell-cell communication. Quorum sensing is a bacterial communication process that leads to the regulation of genes and response to changes<a href="#citations" class="citation">17–19</a>. The quorum sensing has two distinguished systems - AHL and AI-2 for Gram-negative bacteria for now<a href="#citations" class="citation">19–21</a>. We used the circumstances to our advantage: build two genetic circuits that are enhanced by <b>quorum sensing signalling molecules</b>. Both synthetic biological systems are for <b>exolysin synthesis</b>, the difference is how transporter cell lyses itself. Thus, we are introducing three different strength AI-2 inducible promoters: a native <i>lsrACDBFG</i> (<a target="_blank" href="http://parts.igem.org/Part:BBa_K3416000">K3416000</a>) and two mutated ones EP01r (<a target="_blank" href="http://parts.igem.org/Part:BBa_K3416001">K3416001</a>) and EP14r (<a target="_blank" href="http://parts.igem.org/Part:BBa_K3416014">K3416014</a>).
 				</p>
 			</div>
@@ Line 252: / Line 253: @@
 			<div class="content noanim">
 				<p>
-					Our priority plan was to use flavobacterial phage lysins and to test it on a specific bacteria species. But we were unable to acquire neither a phage nor a lysin nor its gene sequence because there is so little research and discoveries made on aquatic phage exolysins<sup>31</sup>.
+					Our priority plan was to use flavobacterial phage lysins and to test it on a specific bacteria species. But we were unable to acquire neither a phage nor a lysin nor its gene sequence because there is so little research and discoveries made on aquatic phage exolysins<a href="#citations" class="citation">31</a>.
 				</p>
 				<p>
@@ Line 264: / Line 265: @@
 				</p>
 				<p>
-					Secondly, to form a biofilm <i>K. pneumoniae</i> uses the same quorum-sensing molecule – autoinducer-2<sup>26</sup>
+					Secondly, to form a biofilm <i>K. pneumoniae</i> uses the same quorum-sensing molecule – autoinducer-2<a href="#citations" class="citation">26</a>
 				</p>
 				<p>
@@ Line 270: / Line 271: @@
 				</p>
 				<p>
-					Lastly, like many other pathogenic bacteria both <i>Flavobacterium</i> species and <i>K.pneumoniae</i> can form biofilms<sup>27</sup>.
+					Lastly, like many other pathogenic bacteria both <i>Flavobacterium</i> species and <i>K.pneumoniae</i> can form biofilms<a href="#citations" class="citation">27</a>.
 				</p>
 			</div>
@@ Line 281: / Line 282: @@
 			<div class="content">
 				<p>
-					Usually, in order to prevent fish infections, vaccines are injected intraperitoneally. Because of manual handling, which is unavoidable in such a type of vaccination, fish experience a lot of stress and it paradoxically weakens their immune system<sup>52</sup>. With the aim to avoid such consequences, we have set the <b>third goal</b> - to create a prevention system based on <b>subunit vaccines</b> against bacterial and viral fish infections.
+					Usually, in order to prevent fish infections, vaccines are injected intraperitoneally. Because of manual handling, which is unavoidable in such a type of vaccination, fish experience a lot of stress and it paradoxically weakens their immune system<a href="#citations" class="citation">52</a>. With the aim to avoid such consequences, we have set the <b>third goal</b> - to create a prevention system based on <b>subunit vaccines</b> against bacterial and viral fish infections.
 				</p>
 			</div>
@@ Line 295: / Line 296: @@
 			<div class="content noanim">
 				<div class="references beforeWave">
-					<h3>References</h3>
+					<h3 id="citations">References</h3>
 					<ol>
 						<li id="cit1">Loch, T. P. & Faisal, M. Emerging flavobacterial infections in fish: A review. <i>Journal of Advanced Research</i> vol. 6 283–300 (2015).</li>
@@ Line 357: / Line 358: @@
 		</div>
 	</main>
-	<script>
-		document.getElementById("fixedOverlay").classList.add("project");
-	</script>
 	<script type="text/javascript" src="https://2020.igem.org/wiki/index.php?title=Template:Vilnius-Lithuania/JSON/LFA&action=raw&ctype=text/javascript"></script>
 	<script type="text/javascript" src="https://2020.igem.org/wiki/index.php?title=Template:Vilnius-Lithuania/JSON/HDA&action=raw&ctype=text/javascript"></script>
@@ Line 376: / Line 374: @@
 				sections: [
 					{ length: 0.245, title: "Sample Pad", text: "The first step in lateral flow assay is a sample, which contains ssDNA molecules obtained during an asymmetric HDA reaction, in addition to the <b>sample application pad</b>, which is made from glass fibre. Then the running buffer is added, which would minimize the nonspecific adsorption and increase the sensitivity and reproducibility of the test. Mentioned sample pad can also be pretreated with different kinds of buffers which help in processing the added fluid." },
-					{ length: 0.03, title: "Conjugate Pad", text: "Fluid absorbed into sample pad flows to the subsequent membrane called a <b>conjugate pad</b>. On this membrane, labelled biorecognition molecules - <b>gold nanoparticles conjugated with detection probes</b> are dispersed. Upon contact with a moving liquid sample, the pad easily releases biorecognition molecules. According to literature research, <b>13 nm gold nanoparticles</b> are the most suitable for LFA based on nucleic acid hybridization<sup>13</sup>. For this reason, we chose to synthesize 13 nm gold nanoparticles using sodium citrate reduction method, otherwise called Turkevich method." },
+					{ length: 0.03, title: "Conjugate Pad", text: "Fluid absorbed into sample pad flows to the subsequent membrane called a <b>conjugate pad</b>. On this membrane, labelled biorecognition molecules - <b>gold nanoparticles conjugated with detection probes</b> are dispersed. Upon contact with a moving liquid sample, the pad easily releases biorecognition molecules. According to literature research, <b>13 nm gold nanoparticles</b> are the most suitable for LFA based on nucleic acid hybridization<a href=\"#citations\" class=\"citation\">13</a>. For this reason, we chose to synthesize 13 nm gold nanoparticles using sodium citrate reduction method, otherwise called Turkevich method." },
 					{ length: 0.065, title: "Gold Nanoparticles", text: "Gold nanoparticles can be bought premade or synthesized in the laboratory. Usually, the Turkevich method with slight modifications is used for synthesis in which HAuCl<sub>4</sub> is reduced by trisodium citrate under reflux conditions. In this technique, citrate ions act as both - stabilizing and reducing agents. The size of gold nanoparticles is determined by the amount of sodium citrate added. With a lower concentration of sodium citrate, larger gold nanoparticles are produced. For LFA test development we also decided to use tannic acid in the gold nanoparticles synthesis process since it helps to maintain the uniformity of gold nanoparticles size." },
-					{ length: 0.095, title: "Detection Probe", text: "Synthesized gold nanoparticles must be functionalized with <b>detection probes</b>. Detection probe is a ssDNA molecule with <b>5’ thiol group modification</b> created to hybridize to HDA produced specific to species ssDNA amplicon. To functionalize gold nanoparticles a method, which includes the step of “aging” with NaCl is used. Salt helps to overcome the long-ranged electrostatic repulsion between the DNA and gold nanoparticles since they are both negatively charged<sup>14</sup>. Our team created probes with <b>poly-A</b> spacer, so an alternative and quicker, low pH assisted method can be used for functionalization<sup>15</sup>. At pH 3, adenine is protonated, and this reduces the repulsion between DNA and gold nanoparticle." },
+					{ length: 0.095, title: "Detection Probe", text: "Synthesized gold nanoparticles must be functionalized with <b>detection probes</b>. Detection probe is a ssDNA molecule with <b>5’ thiol group modification</b> created to hybridize to HDA produced specific to species ssDNA amplicon. To functionalize gold nanoparticles a method, which includes the step of “aging” with NaCl is used. Salt helps to overcome the long-ranged electrostatic repulsion between the DNA and gold nanoparticles since they are both negatively charged<a href=\"#citations\" class=\"citation\">14</a>. Our team created probes with <b>poly-A</b> spacer, so an alternative and quicker, low pH assisted method can be used for functionalization<a href=\"#citations\" class=\"citation\">15</a>. At pH 3, adenine is protonated, and this reduces the repulsion between DNA and gold nanoparticle." },
 					{ length: 0.10, title: "Hybridization", text: "The <b>conjugate pad</b> filled with biorecognition molecules is essential for nucleic acid hybridization.<br>If specific ssDNA from the HDA reaction is present in the sample, then the first hybridization reaction occurs between the <b>detection probe and ssDNA amplicon</b>. The newly formed complex immediately flows to the subsequent nitrocellulose membrane.<br>If the added sample does not have a ssDNA amplicon, then no hybridization occurs in the conjugate pad. The labelled gold nanoparticles that are unhybridized to ssDNA continue flowing further." },
 					{ length: 0.11, title: "Test Line", text: "Mentioned nitrocellulose membrane has two lines with dispersed DNA probes. The first line is called the <b>test line</b>, and the further line is the <b>control line</b>. On the test line, capture probes are dispersed. When the fluid reaches the test line, another hybridization reaction occurs between the <b>capture probe and ssDNA amplicon-gold nanoparticle complex</b>. Since capture probes are immobilized on the membrane, the resulting complex does not move any further and stays on the test line. Eventually, due to hybridization gold nanoparticles start to accumulate and the red line becomes visible to the naked eye. If there is no specific ssDNA amplicon in the sample, then no hybridization takes place and labeled gold nanoparticles move further down the membrane." },
-					{ length: 0.15, title: "Control Line", text: "In the conjugate pad, not all labelled gold nanoparticles hybridize to ssDNA amplicon, meaning that there are gold nanoparticles with free detection probes. This is important for the <b>control line</b> where control probes are immobilized. Since the control probe is complementary to the detection probe, <b>hybridization between the probes</b> occurs resulting in the red line formation. Mentioned hybridization reaction has to occur during each test because it shows that the test operated correctly.<br>We chose to use Hi-Flow plus HF180 nitrocellulose membrane, which has a nominal capillary <b>flow time of 180 seconds/4cm</b>, which is relatively slow. The migration speed of the fluid is critical because it affects the response of the test. Slower flow membrane results in a longer time assay, but response signal is higher, and lines are better defined<sup>13</sup>. To get the best results optimization is needed. For this reason, we decided to create a software tool - <a target=\"_blank\" href=\"https://2020.igem.org/Team:Vilnius-Lithuania/Software\">OnFlow</a> that is based on our LFA <a target=\"_blank\" href=\"https://2020.igem.org/Team:Vilnius-Lithuania/Model\">mathematical model</a>. OnFlow helps to find the best place where to spray probes and the exact amount of analyte needed to obtain the most visible results on the strip." },
+					{ length: 0.15, title: "Control Line", text: "In the conjugate pad, not all labelled gold nanoparticles hybridize to ssDNA amplicon, meaning that there are gold nanoparticles with free detection probes. This is important for the <b>control line</b> where control probes are immobilized. Since the control probe is complementary to the detection probe, <b>hybridization between the probes</b> occurs resulting in the red line formation. Mentioned hybridization reaction has to occur during each test because it shows that the test operated correctly.<br>We chose to use Hi-Flow plus HF180 nitrocellulose membrane, which has a nominal capillary <b>flow time of 180 seconds/4cm</b>, which is relatively slow. The migration speed of the fluid is critical because it affects the response of the test. Slower flow membrane results in a longer time assay, but response signal is higher, and lines are better defined<a href=\"#citations\" class=\"citation\">13</a>. To get the best results optimization is needed. For this reason, we decided to create a software tool - <a target=\"_blank\" href=\"https://2020.igem.org/Team:Vilnius-Lithuania/Software\">OnFlow</a> that is based on our LFA <a target=\"_blank\" href=\"https://2020.igem.org/Team:Vilnius-Lithuania/Model\">mathematical model</a>. OnFlow helps to find the best place where to spray probes and the exact amount of analyte needed to obtain the most visible results on the strip." },
 					{ length: 0.12, title: "Absorbent Pad", text: "Finally, the last membrane is the <b>absorbent pad</b> which helps in maintaining the flow rate of the liquid over the membrane and stops backflow of the sample. Also, it absorbs excess fluid. Different kinds of membranes are assembled with overlapping ends (2mm) to ensure that continuous flow is achieved and mounted over a backing card which helps as support and makes it easy to handle the test." },
 				],
@@ Line 407: / Line 405: @@
 					{ length: 0.01, title: "Derepression", text: "LsrR+AI-2-P (repressor and bound phosphorylated autoinducer-2) dissociates from the repressed promoter." },
 					{ length: 0.10, title: "Exolysin", text: "This initiates AI-2 induced promoter and 2 protein-coding genes transcription.<br>The main protein of this genetic circuit is a specific exolytic virus protein which is naturally located on the tail fibers of a virus. <b>Exolysins</b> are highly specific and, thus, largely determine the host spectrum of the phage (mostly specific to single bacterial species but also are often specific to only a few strains within that species). The idea is to synthesize <i>Flavobacterium</i> <b>bacteriophage’s depolymerase</b> and use it as a drug that destroys the biofilm. In addition to this, the phage can have multiple <b>different exolysin proteins</b> which broadens the host spectrum." },
-					{ length: 0.20, title: "Endolysin", text: "The <b>toxin lysECD7</b> is a broad-range endolysin that targets cell membrane peptidoglycans and results in a quick cell degradation<sup>29</sup>." },
+					{ length: 0.20, title: "Endolysin", text: "The <b>toxin lysECD7</b> is a broad-range endolysin that targets cell membrane peptidoglycans and results in a quick cell degradation<a href=\"#citations\" class=\"citation\">29</a>." },
 					{ length: 0.38, title: "<i>E. coli</i> lysis", text: "Finally, the concentration of our toxin increases until it reaches the critical point where our <i>E. coli</i> bursts. In the end, a high concentration of exolysin is released to the bacterial infection site." },
 				],
@@ Line 417: / Line 415: @@
 				animBegin: 0.05,
 				sections: [
-					{ length: 0.52, title: "Biofilm", text: "Flavobacterial diseases occur when <b><i>Flavobacterium</i> biofilm</b> forms on fish gills or fins. Like other pathogenic bacteria, the biofilm formed by <i>Flavobacterium spp.</i> is responsible for increasing the resistance of antibiotics. These biofilms aggravate the breathing of fish and cause internal organ failure<sup>22</sup>. Due to this, infected fish die in 24-72 hours after the first physical changes on fish appearance are seen." },
+					{ length: 0.52, title: "Biofilm", text: "Flavobacterial diseases occur when <b><i>Flavobacterium</i> biofilm</b> forms on fish gills or fins. Like other pathogenic bacteria, the biofilm formed by <i>Flavobacterium spp.</i> is responsible for increasing the resistance of antibiotics. These biofilms aggravate the breathing of fish and cause internal organ failure<a href=\"#citations\" class=\"citation\">22</a>. Due to this, infected fish die in 24-72 hours after the first physical changes on fish appearance are seen." },
-					{ length: 0.31, title: "AI-2", text: "<i>Flavobacterium</i> uses the same signalling molecule as <i>E. coli</i> - autoinducer-2 (AI-2).<br><i>Flavobacterium</i> is a gram-negative bacteria that uses a <i>universal</i> interspecies signalling molecule so-called <b>AI-2</b> for cell-to-cell communication. This action is often called <b>quorum sensing</b>. Type II quorum system is based on autoinducer-2 (AI-2) secretion and uptake. Autoinducer-2 is a furanosyl borate diester that is derived from 4,5-dihydroxy-2,3-pentanedione (DPD). DPD can spontaneously form different isomers which can be recognized as the signalling molecules as well<sup>23-25</sup>. During the biofilm formation, the <b>AI-2 concentration skyrockets</b>. Therefore, we thought that using AI-2 induced promoter would be a perfect <a target=\"_blank\" href=\"https://2020.igem.org/Team:Vilnius-Lithuania/Engineering#treatment-section\">sensing system</a> <b>to start producing ‘killer-protein’</b>." },
+					{ length: 0.31, title: "AI-2", text: "<i>Flavobacterium</i> uses the same signalling molecule as <i>E. coli</i> - autoinducer-2 (AI-2).<br><i>Flavobacterium</i> is a gram-negative bacteria that uses a <i>universal</i> interspecies signalling molecule so-called <b>AI-2</b> for cell-to-cell communication. This action is often called <b>quorum sensing</b>. Type II quorum system is based on autoinducer-2 (AI-2) secretion and uptake. Autoinducer-2 is a furanosyl borate diester that is derived from 4,5-dihydroxy-2,3-pentanedione (DPD). DPD can spontaneously form different isomers which can be recognized as the signalling molecules as well<a href=\"#citations\" class=\"citation\">23-25</a>. During the biofilm formation, the <b>AI-2 concentration skyrockets</b>. Therefore, we thought that using AI-2 induced promoter would be a perfect <a target=\"_blank\" href=\"https://2020.igem.org/Team:Vilnius-Lithuania/Engineering#treatment-section\">sensing system</a> <b>to start producing ‘killer-protein’</b>." },
 				],
 			},
@@ Line 427: / Line 425: @@
 				animBegin: 0.05,
 				sections: [
-					{ length: 0.10, title: "Lateral Flow Assay Results", text: "To make sure that the test is as convenient as possible, we collaborated with Micromold to create a 3D model of the lateral flow assay test case. The created case has a specially designed well to add the liquid onto the sample pad and the window meant to observe the results. Also, this case makes sure that the test strip with dried reagents is protected from the environment." },
+					{ length: 0.10, title: "Lateral Flow Assay Results", text: "To make sure that the test is as convenient as possible, we collaborated with Micromolds to create a 3D model of the lateral flow assay test case. The created case has a specially designed well to add the liquid onto the sample pad and the window meant to observe the results. Also, this case makes sure that the test strip with dried reagents is protected from the environment. The design of this test case was a crucial step for the future implementation of the test in aquaculture farms." },
-					{ length: 0.29, text: "The developed qualitative lateral flow assay test can give three different answers:<br>Positive - If test and control lines are present." },
+					{ length: 0.29, text: "The developed qualitative lateral flow assay test can give three different answers:<br><b>Positive</b> - If test and control lines are present." },
-					{ length: 0.17, text: "Negative - If only the control line appears." },
+					{ length: 0.17, text: "<b>Negative</b> - If only the control line appears." },
-					{ length: 0.39, text: "No lines / only test line - the test is invalid and must be repeated. This might have happened due to problems of the fluid flow." },
+					{ length: 0.39, text: "<b>No lines / only test line</b> - the test is invalid and must be repeated. This might have happened due to problems of the fluid flow." },
 				],
 			},
@@ Line 439: / Line 437: @@
 				animBegin: 0.013,
 				sections: [
-					{ length: 0.017, noanim: true, bigTitle: "Subunit Vaccines", text: "<b>Subunit vaccines</b> are based on proteins that induce a specific immune response against an exact pathogen. These immunogenic proteins cannot replicate in the host. Thus there is no risk of infection to the host or non-target species<sup>36</sup>. Additionally, the chances of spontaneous reversions or denaturing of antigenic peptides, which occur by using attenuated or inactivated virus vaccines, are reduced. Considering that these subunit vaccines will be used in aquaculture farms, a vital aspect of the prevention system are its easy transportation and storage conditions. Subunit vaccines can be freeze-dried, allowing non-refrigerated transport and storage<sup>37</sup>." },
+					{ length: 0.017, noanim: true, bigTitle: "Subunit Vaccines", text: "<b>Subunit vaccines</b> are based on proteins that induce a specific immune response against an exact pathogen. These immunogenic proteins cannot replicate in the host. Thus there is no risk of infection to the host or non-target species<a href=\"#citations\" class=\"citation\">36</a>. Additionally, the chances of spontaneous reversions or denaturing of antigenic peptides, which occur by using attenuated or inactivated virus vaccines, are reduced. Considering that these subunit vaccines will be used in aquaculture farms, a vital aspect of the prevention system are its easy transportation and storage conditions. Subunit vaccines can be freeze-dried, allowing non-refrigerated transport and storage<a href=\"#citations\" class=\"citation\">37</a>." },
-					{ length: 0.03, title: "Bacterial Pathogens", text: "In the beginning, our primary goal was to immunise fish against one of the chosen <i>Flavobacterium</i> - <i>F. columnare</i>. Firstly, we considered picking <i>F. psychrophilum</i> or <i>F. branchiophilum</i>. However, after our research, we decided to focus on <i>F. columnare</i>, similar to other strains by its severity, yet having a well studied and effectively immunogenic outer membrane protein <a target=\"_blank\" href=\"http://parts.igem.org/Part:BBa_K3416007\"><b>GldJ</b></a>, which has well-exposed epitopes on its surface, recognized by fish immune cells<sup>39</sup>." },
+					{ length: 0.03, title: "Bacterial Pathogens", text: "In the beginning, our primary goal was to immunise fish against one of the chosen <i>Flavobacterium</i> - <i>F. columnare</i>. Firstly, we considered picking <i>F. psychrophilum</i> or <i>F. branchiophilum</i>. However, after our research, we decided to focus on <i>F. columnare</i>, similar to other strains by its severity, yet having a well studied and effectively immunogenic outer membrane protein <a target=\"_blank\" href=\"http://parts.igem.org/Part:BBa_K3416007\"><b>GldJ</b></a>, which has well-exposed epitopes on its surface, recognized by fish immune cells<a href=\"#citations\" class=\"citation\">39</a>." },
-					{ length: 0.03, title: "Viral Pathogens", text: "However, after a virtual meeting with <b>Darius Nienius, deputy director of National Food and Veterinary Risk Assessment Institute of Lithuania</b>, we were informed that <b>viruses</b> are equally dangerous to aquaculture farms as are bacteria. It was explained that viral infections are tough to deal with because while bacterial infections can be treated with antibiotics, there are barely any commercial drugs for viral infections. Especially problematic one - <b>viral hemorrhagic septicemia virus</b> (<b class=\"semi\">VHSV</b>) - does not have a commercially available vaccine yet<sup>51</sup>, so we added it to our focus pathogens. VHSV has <a target=\"_blank\" href=\"http://parts.igem.org/Part:BBa_K3416004\"><b>Glycoprotein G</b></a> on its surface, which induces an immune response against the virus in fish<sup>38</sup>." },
+					{ length: 0.03, title: "Viral Pathogens", text: "However, after a virtual meeting with <b>Darius Nienius, deputy director of National Food and Veterinary Risk Assessment Institute of Lithuania</b>, we were informed that <b>viruses</b> are equally dangerous to aquaculture farms as are bacteria. It was explained that viral infections are tough to deal with because while bacterial infections can be treated with antibiotics, there are barely any commercial drugs for viral infections. Especially problematic one - <b>viral hemorrhagic septicemia virus</b> (<b class=\"semi\">VHSV</b>) - does not have a commercially available vaccine yet<a href=\"#citations\" class=\"citation\">51</a>, so we added it to our focus pathogens. VHSV has <a target=\"_blank\" href=\"http://parts.igem.org/Part:BBa_K3416004\"><b>Glycoprotein G</b></a> on its surface, which induces an immune response against the virus in fish<a href=\"#citations\" class=\"citation\">38</a>." },
-					{ length: 0.03, title: "GFP", text: "To ensure that the <b>encapsulation process</b> does not damage the proteins, we had to test it on easily examinable protein. By using purified a green fluorescent protein with 6xHis tag and by treating it with the most common digestive enzymes in their appropriate buffer, we can tell whether green fluorescent protein is intact and or when it was degraded in a plate reader assay. By adding the same amount of alginate beads of the same size into the plate reader and by reading emission we can determine whether alginate beads would pass through the digestive tract of the fish and how much of the protein would be lost during that process<sup>58</sup>." },
+					{ length: 0.03, title: "GFP", text: "To ensure that the <b>encapsulation process</b> does not damage the proteins, we had to test it on easily examinable protein. By using purified a green fluorescent protein with 6xHis tag and by treating it with the most common digestive enzymes in their appropriate buffer, we can tell whether green fluorescent protein is intact and or when it was degraded in a plate reader assay. By adding the same amount of alginate beads of the same size into the plate reader and by reading emission we can determine whether alginate beads would pass through the digestive tract of the fish and how much of the protein would be lost during that process<a href=\"#citations\" class=\"citation\">58</a>." },
 					{ length: 0.03, title: "Protein synthesis", text: "For GldJ protein synthesis, we have chosen a strategy based on a bacterial protein expression system. The GldJ coding sequence was cloned into pET28-a(+) vector. In parallel, for VHSV protein synthesis, we decided to use yeast. VHSV was cloned into a pfX-7 vector and transformed into <i>S. cerevisiae</i>." },
-					{ length: 0.09, title: "Why Alginate", text: "We decided to encapsulate the immunogenic proteins in <b>calcium alginate beads</b>. Using brown algae (kelp) polysaccharide - <b>alginate</b>, the same protective effect against digestive enzymes and pH differences occurring in the fish gut as with live algae could be achieved. Alginate is <b>cheaper</b> and <b>safer</b> for the environment as it does not rely on living genetically modified algae species, reducing the chance of spreading organisms in the ecosystem. The <b>calcium alginate layer</b> is biocompatible and highly resistant to acidic or digestive environments<sup>45</sup>. Alginate cannot be broken down in the fish stomach and the pyloric caeca without the help of bacteria. Calcium makes protein absorption more rapid<sup>46</sup>." },
+					{ length: 0.09, title: "Why Alginate", text: "We decided to encapsulate the immunogenic proteins in <b>calcium alginate beads</b>. Using brown algae (kelp) polysaccharide - <b>alginate</b>, the same protective effect against digestive enzymes and pH differences occurring in the fish gut as with live algae could be achieved. Alginate is <b>cheaper</b> and <b>safer</b> for the environment as it does not rely on living genetically modified algae species, reducing the chance of spreading organisms in the ecosystem. The <b>calcium alginate layer</b> is biocompatible and highly resistant to acidic or digestive environments<a href=\"#citations\" class=\"citation\">45</a>. Alginate cannot be broken down in the fish stomach and the pyloric caeca without the help of bacteria. Calcium makes protein absorption more rapid<a href=\"#citations\" class=\"citation\">46</a>." },
-					{ length: 0.20, title: "Protein Encapsulation", text: "The protein must be protected from partial or full digestion in the stomach of the fish. We found that scientists have already tried feeding fish with green fluorescent protein which was bio encapsulated in lyophilised Chlamydomonas reinhardtii. Non-digested green fluorescent protein was then found in fish blood and plasma, as well as in intestinal tissues<sup>44</sup>." },
+					{ length: 0.20, title: "Protein Encapsulation", text: "The protein must be protected from partial or full digestion in the stomach of the fish. We found that scientists have already tried feeding fish with green fluorescent protein which was bio encapsulated in lyophilised Chlamydomonas reinhardtii. Non-digested green fluorescent protein was then found in fish blood and plasma, as well as in intestinal tissues<a href=\"#citations\" class=\"citation\">44</a>." },
 					{ length: 0.06, title: "Digestive Tract Environment", text: "The biggest issue with oral subunit vaccines is that the protein needs to be absorbed into the bloodstream to induce an immune response, and some of it is lost in the process while going through the digestive tract. As mentioned above, due to the gastrointestinal tract’s severe environment, a significant amount of the vaccine is lost before reaching the target environment." },
-					{ length: 0.21, title: "Delivery Route", text: "Therefore, an oral vaccine administration route can be used. In this way, the bioactive substances are given together with the fish food. All things considered, we concluded that <b>subunit vaccination with GldJ and VHSV G proteins</b> should be administered orally as it is considered relatively non-invasive.<br><span class=\"deviation\">Why oral?<br><br>There are a few vaccine delivery routes, such as intraperitoneal or immersion, to be considered. Unfortunately, physical intervention is required for the most commonly used immunization method, which causes stress to the animals and weakens their immune system<sup>40</sup>. In addition, intraperitoneal injections are not suitable for juveniles, the most susceptible to VHSV group. Injection lesions cause scarring and increase the risk of wound infection<sup>41</sup>. The process of vaccination is also not practical cost and labour wise<sup>42</sup>. According to standard vaccination via needle procedure, fish need to be sedated and then separated individually, which requires intense human labor<sup>43</sup>.</span>" },
+					{ length: 0.21, title: "Delivery Route", text: "Therefore, an oral vaccine administration route can be used. In this way, the bioactive substances are given together with the fish food. All things considered, we concluded that <b>subunit vaccination with GldJ and VHSV G proteins</b> should be administered orally as it is considered relatively non-invasive.<br><span class=\"deviation\">Why oral?<br><br>There are a few vaccine delivery routes, such as intraperitoneal or immersion, to be considered. Unfortunately, physical intervention is required for the most commonly used immunization method, which causes stress to the animals and weakens their immune system<a href=\"#citations\" class=\"citation\">40</a>. In addition, intraperitoneal injections are not suitable for juveniles, the most susceptible to VHSV group. Injection lesions cause scarring and increase the risk of wound infection<a href=\"#citations\" class=\"citation\">41</a>. The process of vaccination is also not practical cost and labour wise<a href=\"#citations\" class=\"citation\">42</a>. According to standard vaccination via needle procedure, fish need to be sedated and then separated individually, which requires intense human labor<a href=\"#citations\" class=\"citation\">43</a>.</span>" },
-					{ length: 0.16, title: "Alginate Lysis", text: "Alginates can only be enzymatically depolymerised by <b>alginate lyases</b> (<b class=\"semi\">algLs</b>). Lyases catalyse β-elimination reaction of glycoside bonds to yield a 4,5-unsaturated sugar, 4-deoxy-L-erythro-hex-4-enopyranosyluronic acid at the non-reducing end47. Some bacteria can produce algLs and in that way can degrade alginate into oligosaccharides or monosaccharides. Some examples of such bacteria are <i>Bacillus circulans, Azotobacter vinelandii, Klebsiella aerogenes, K. pneumonia, Pseudomonas maltophilia, P. putida</i>, and <i>P. aeruginosa</i><sup>48</sup>.<br><span class=\"deviation\">How was it tested?<br><br>After literature analysis, we discovered that the same bacteria used for our treatment part - <i>Klebsiella pneumoniae</i> - can secrete alginate lyase. In order to test if the lyase degrades our alginate encapsulation, we experimented by adding some of the alginate beads into <i>Klebsiella pneumonia</i> liquid culture. <i>E. coli</i>, which does not secrete alginate lyase, was used as a control<sup>50</sup>.</span>" },
+					{ length: 0.16, title: "Alginate Lysis", text: "Alginates can only be enzymatically depolymerised by <b>alginate lyases</b> (<b class=\"semi\">algLs</b>). Lyases catalyse β-elimination reaction of glycoside bonds to yield a 4,5-unsaturated sugar, 4-deoxy-L-erythro-hex-4-enopyranosyluronic acid at the non-reducing end47. Some bacteria can produce algLs and in that way can degrade alginate into oligosaccharides or monosaccharides. Some examples of such bacteria are <i>Bacillus circulans, Azotobacter vinelandii, Klebsiella aerogenes, K. pneumonia, Pseudomonas maltophilia, P. putida</i>, and <i>P. aeruginosa</i><a href=\"#citations\" class=\"citation\">48</a>.<br><span class=\"deviation\">How was it tested?<br><br>After literature analysis, we discovered that the same bacteria used for our treatment part - <i>Klebsiella pneumoniae</i> - can secrete alginate lyase. In order to test if the lyase degrades our alginate encapsulation, we experimented by adding some of the alginate beads into <i>Klebsiella pneumonia</i> liquid culture. <i>E. coli</i>, which does not secrete alginate lyase, was used as a control<a href=\"#citations\" class=\"citation\">50</a>.</span>" },
-					{ length: 0.07, title: "Decomposition of Alginate Envelope", text: "<b>Calcium alginate envelopes</b> can only be decomposed in the midgut - the exact place where <i>Pseudomonas</i> bacteria live<sup>49</sup>. In addition, mineral and biomolecule absorption is most intensive in the fish midgut. It is an ideal environment for our protein to be stripped out of calcium alginate beads and pass through the gut wall barrier into the bloodstream. Immune cells would then start producing antibodies against this specific pathogen protein, forming the protective immunity." },
+					{ length: 0.07, title: "Decomposition of Alginate Envelope", text: "<b>Calcium alginate envelopes</b> can only be decomposed in the midgut - the exact place where <i>Pseudomonas</i> bacteria live<a href=\"#citations\" class=\"citation\">49</a>. In addition, mineral and biomolecule absorption is most intensive in the fish midgut. It is an ideal environment for our protein to be stripped out of calcium alginate beads and pass through the gut wall barrier into the bloodstream. Immune cells would then start producing antibodies against this specific pathogen protein, forming the protective immunity." },
 					{ length: 0.03, title: "Validation", text: "To test that alginate beads can protect from environmental damage and fish digestive system, we continued to examine the beads in vitro. With more time the immunogenic properties of the proteins could be tested in vivo by feeding the fish with oral subunit vaccines in a two-step immunization program and challenging them with a bath containing pathogens of interest." },
 				],
@@ Line 463: / Line 461: @@
 					{ length: 0.01, title: "Phosphorylation", text: "Phosphorylated AI-2-P binds to a repressor LsrR. Consequently, LsrR undergoes conformational changes and its affinity towards repressed promoter weakens." },
 					{ length: 0.03, title: "Derepression", text: "LsrR+AI-2-P (repressor and bound phosphorylated autoinducer-2) dissociates from the repressed promoter." },
-					{ length: 0.03, title: "Exolysin", text: "This initiates AI-2 induced promoter and exolysin synthesis.<br>The main protein of this genetic circuit is a specific exolytic virus protein which is naturally located in the tail fibers of a virus<sup>34</sup>. Exolysins are highly specific and, thus, largely determine the host spectrum of the phage (mostly specific to single bacterial species but also are often specific to only a few strains within that species)<sup>33</sup>. The idea is to synthesize <i>Flavobacterium</i> bacteriophage’s depolymerase and use it as a drug that destroys the biofilm." },
+					{ length: 0.03, title: "Exolysin", text: "This initiates AI-2 induced promoter and exolysin synthesis.<br>The main protein of this genetic circuit is a specific exolytic virus protein which is naturally located in the tail fibers of a virus<a href=\"#citations\" class=\"citation\">34</a>. Exolysins are highly specific and, thus, largely determine the host spectrum of the phage (mostly specific to single bacterial species but also are often specific to only a few strains within that species)<a href=\"#citations\" class=\"citation\">33</a>. The idea is to synthesize <i>Flavobacterium</i> bacteriophage’s depolymerase and use it as a drug that destroys the biofilm." },
 					{ length: 0.08, title: "<i>mazE</i>", text: "Simultaneously under weak constitutive promoter <i>mazE</i> gene product is synthesized. <i>MazE</i> is antitoxin in <i>mazEF</i> system." },
-					{ length: 0.06, title: "<i>mazF</i>", text: "MazF takes a toxin role in this system. MazF – sequence-specific endoribonuclease, which cleaves mRNA at ACA site and terminates protein synthesis<sup>32</sup>." },
+					{ length: 0.06, title: "<i>mazF</i>", text: "MazF takes a toxin role in this system. MazF – sequence-specific endoribonuclease, which cleaves mRNA at ACA site and terminates protein synthesis<a href=\"#citations\" class=\"citation\">32</a>." },
 					{ length: 0.15, title: "<i>mazEF</i> complex", text: "When MazE concentration is equal to MazF, it inhibits toxin by forming a heterocomplex. This module exists as a polypeptide chain which includes one globular MazE homodimer sitting between two symmetrically arrayed MazF homodimers." },
 					{ length: 0.39, title: "<i>E. coli</i> lysis", text: "However, MazF concentration bypasses MazE concentration, MazF disrupts necessary protein synthesis and invokes cell lysis. In the end, and releases a high concentration of exolysin is released to the bacterial infection site." },

Difference between revisions of "Team:Vilnius-Lithuania/Design"

Latest revision as of 00:08, 19 December 2020

Loading...

project

wet lab

dry lab

humanpractices

team

References

contact us

follow us

project

wet lab

dry lab

human practices

team

human
practices