Team:Vilnius-Lithuania/Results
Goal - To create a LFA test that can be used for F. columnare and F. psychrophilum species specific HDA amplicon identification in the farm. As well as to enhance HDA efficiency by using a binary helimerase complex.
Results - The test created for F. psychrophilum worked as we expected and was able to positively identify only F. psychrophilum species, whereas specificity of F. columnare test was lower and potentially could lead to false positive results. Synthesized proteins to form helimerase showed activity, however they did not form electrostatic interactions in vivo or in vitro.
Future directions - To improve overall performance of the test, experiments are needed to intensify the colour of the test and control lines as well as specificity of F. columnare LFA test. This could be achieved by doing sample dilutions or testing a different marker gene. Also, further optimization of TteUvrD and BstPol proteins interaction in vivo and in vitro needs to be done with the aim to enhance HDA amplification efficiency.
Infections caused by Flavobacterium genus spread incredibly fast and are of an immense threat to aquaculture farms. For this reason, it's crucial to detect F. columnare or F. psychrophilum caused infections as soon as possible. However, the majority of the time this identification is delayed and causes huge losses for aquaculture farms. To solve this issue, we decided to create a rapid detection tool based on helicase dependent amplification (HDA) and lateral flow assay test (LFA).
Since we decided to base our detection system on nucleic acid hybridization, the first crucial step was to find unique to different Flavobacterium species marker genes. 16S ribosomal RNA gene (AY577821) was selected for F. columnare (ATCC 23463) strain. Whereas rpoC gene (JX657167.1) was chosen for F. psychrophilum (ATCC 49418) strain1.
To make sure that the test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1.2.4.). Probe placement for F. columnare was selected based on the absence of matching alignments between sequences (Fig. 1). For the rpoC gene, meant to identify F. psychrophilum we chose 205 - 250 bp region to place detection and capture probes.
Figure 1. Flavobacterium species 16S rRNA partial gene sequences alignment. Black boxes highlight sequence parts chosen for probe placement. Gene sequences: F. columnare - AY577821, F. branchiophilum - AB680752, F. psychrophilum - AY662493.
ssDNA probes were created for the chosen regions in marker genes (Table 1). Detection and capture probes were created to be complementary for the negative strand of the DNA. Control probe is complementary to the detection probe. ssDNA probes for F. columnare were created according to parameters proposed in the research paper2. When creating probes for F. psychrophilum we decided to make them longer and of greater GC% content in hopes that hybridization reaction in the LFA test would be improved.
| Species | Probe type | Sequence and its modification | Location | Parameters |
|---|---|---|---|---|
| F. columnare 16S rRNA gene | Detection probe | ThioMC6-D-(A)20-TTTCAGATG | 172 - 180 bp | Tm = 15.4°C GC% = 33.3% size = 29 nt |
| Capture probe | GCCTCATTTGATT-(A)20-bio | 181 - 193 bp | Tm = 36.5°C GC% = 38.5% size = 33 nt | |
| Control probe | biosg-(A)20-CATCTGAAA | - | Tm = 15.4°C GC% = 33.3% size = 29 nt | |
| F. psychrophilum rpoC gene | Detection probe | ThioMC6-D-(A)20-ATTCCTTACGGTTCAAGTAT | 205 - 224 bp | Tm = 48.5°C GC% = 35% size = 40 nt |
| Capture probe | AAATGACGCTCAAGTTGTAG-(A)20-bio | 231 - 250 bp | Tm = 48.5°C GC% = 35% size = 40 nt | |
| Control probe | biosg-(A)20-ATACTTGAACCGTAAGGAAT | - | Tm = 48.5°C GC% = 35% size = 40 nt |
Table 1. Parameters of ssDNA probes created for nucleic acid lateral flow assay test. Tm and GC% was calculated without poly-A sequence using IDT oligo analyzer tool. (A)20 marks poly-A sequence of 20 adenines. Bio and Biosg means biotin modification and ThioMC6-D - Thiol group modification at appropriate ends of the sequence.
After exact placement of probes was known, primers for HDA were created to make sure that the amplicon will have necessary detection and capture probe hybridization sites (Table 2). Primers were made using IDT primer quest tool. Blast analysis results showed that amplicons are specific only to the exact species of bacteria we wanted to identify.
| Primer | Amplicon | |||||
|---|---|---|---|---|---|---|
| bp | GC% | Tm, °C | bp | Tm, °C | ||
| Recommended parameter ranges for HDA | 20-35 | 30-60 | 60-80 | 70-120 | 68-77 | |
| CAGGGGGATAGCCCAGAGAAATTTGG | F_Col | 26 | 53.8 | 73.9 | 122 | 75 |
| ACCACACCAACTAGCTAATGGGACGC | R_Col | 26 | 53.8 | 72.2 | ||
| ACGGGTATTCTTCTTGCTACAAATA | F_Psy | 25 | 36.0 | 62.9 | 104 | 70 |
| GGATCCCATTTACAAATAACATCTCC | R_Psy | 26 | 38.5 | 65.3 | ||
Table 2. Used primers and amplicons parameters. Calculations were made using the Thermo Fisher multiple primer analyzer tool. All parameters are in the ranges suggested by HDA amplification kit manufacturers.
Symmetric and asymmetric HDA as well as PCR were performed with the created primers (Fig. 2). PCR amplification using F. psychrophilum gDNA as a template and F_Psy, R_Psy primers proved to be specific to species (Fig. 2, C). In contrast, PCR amplification of F. columnare gDNA fragment with F_Col and R_Col primers showed less specificity than we imagined (Fig. 2, A). Nonetheless both asymmetric amplifications were successful and the average concentration of ssDNA was 2.53-2.96 μM as measured by qubit fluorometer.
Also, HDA amplification with F. psychrophilum gDNA was successful and the product could be seen in a gel (Fig. 2, B). On the other hand HDA using F. columnare gDNA as a template proved to be difficult to perform and improve. Even though the product could not be seen in a gel after electrophoresis, by using qubit fluorometer we determined that the average concentration of amplicon after symmetric and asymmetric HDA was around 0.7 μM for both species. This concentration is lesser than we expected but still suitable to be detected by the LFA test.
Figure 2. Left to right: A. L - gene ruler 50 bp ladder (SM0371), 1 - F. columnare symmetric PCR with F_Col and R_Col primers, 2 - F. psychrophilum symmetric PCR with F_Col and R_Col primers, 3 - E. coli symmetric PCR with F_Col and R_Col primers, 4 - F. columnare asymmetric PCR with F_Col and R_Col primers (1:15), B. L - gene ruler 50 bp ladder (SM0371), 5 - F. columnare symmetric HDA, 6 - F. psychrophilum symmetric HDA, C. 7- F. psychrophilum symmetric PCR with F_Psy and R_Psy primers , 8 - F. columnare symmetric PCR with F_Psy and R_Psy primers, 9 - E. coli symmetric PCR with F_Psy and R_Psy primers, 10 - F. psychrophilum asymmetric PCR with F_Psy and R_Psy primers (1:15), L - gene ruler 50 bp ladder (SM0371). After amplification with F_Col and R_Col primers fragment size should be 122 bp and for F_Psy, R_Psy - 104 bp.
Created detection probes (Table 1) need to be immobilized on the gold nanoparticles. We decided to chemically synthesize these 13 nm gold nanoparticles using modified Turkevich method. Synthesized AuNP were characterized by using NanoSight NS300 instrument. The results showed that the mode of size for gold nanoparticles was 25.4 nm. The size is greater than expected but some slight variation can be present using such characterization method.
To get the most accurate results, analysis using dynamic light scattering and transmission or scanning electron microscopy should be performed as well. We concluded that synthesized gold nanoparticles were of suitable parameters for further functionalization reactions.
During the functionalization reaction, ssDNA detection probes are conjugated to the gold nanoparticle itself. Since created probes had a poly-A sequence, a low pH assisted method was used. No change in colour of the gold nanoparticles solution during NaCl test indicated a lack of aggregation and successful functionalization reaction. However, a more appropriate evaluation method was required.
For this reason absorption spectrum of nanoparticles before and after functionalization was determined (Fig. 3). Before functionalization gold nanoparticles had an absorption peak at 522 nm whereas after conjugation to F. columnare or F. psychrophilum detection probes, absorption peak shifted to 527 and 529 nm respectively. This shift is expected and indicates a successful functionalization reaction2.
Figure 3. Gold nanoparticles (Au-NP) absorption spectra determined with UV-Visible spectrophotometry. Blue line indicates nanoparticles absorption before conjugation to detection probes, yellow line - after functionalization with F. psychrophilum probes whereas orange line shows absorption after functionalization with F. columnare detection probes.
Finally, having all necessary reagents and membranes, the LFA tests were assembled (Fig. 4). Functionalized gold nanoparticles can be found in the conjugate pad. Capture and control probes were sprayed on the test line and control line respectively. After this we had two sets of tests created to identify F. columnare and F. psychrophilum. Different running buffers were tested and it was determined that running buffer II (10X SSC, 3.5% Triton X-100, 0.25% SDS, 12.5% formamide) was the most suitable since tests resulted in the most clearly visible red lines. The next step was to evaluate specificity and accuracy.
Figure 4. LFA test dimensions.
At first the LFA test using 16S ribosomal RNA gene was created to identify F. psychrophilum but its specificity was low and could not be improved, meaning that the test became positive with amplicons other than F. psychrophilum. However, a redesigned test using the rpoC gene proved to be more specific and was able to differentiate F. psychrophilum from F. columnare as well as from E. coli and F. piscis (Fig. 5). These results meant that the test can be used for accurate F. psychrophilum species identification.
Figure 5. Specificity experiment of F. psychrophilum identification LFA test. Tests were evaluated using 100 nM of DNA in 100 μL of running buffer II. 1 - F. psychrophilum asymmetric HDA with F_Psy and R_Psy primers, 2 - F. psychrophilum symmetric HDA with F_Psy and R_Psy primers after denaturation, 3 - F. psychrophilum asymmetric PCR with F_Psy and R_Psy primers, 4 - F. psychrophilum symmetric PCR with F_Psy and R_Psy primers after denaturation, 5 - F. psychrophilum asymmetric PCR with F_Col and R_Col primers, 6 - F. columnare asymmetric PCR with F_Psy and R_Psy primers, 7 - F. piscis asymmetric PCR with F_Psy and R_Psy primers, 8 - E. coli asymmetric PCR with F_Psy and R_Psy primers, 9 - no DNA template. CL indicates control line, TL - test line.
However, the LFA test created for F. columnare identification showed less exciting results (Fig. 6). We determined that it was able to differentiate between F. psychrophilum and F. columnare as well as F. piscis but was unable to distinct F. columnare from E. coli. This can lead to false positive results. In the future further optimization experiments should be performed to see if specificity of the test could be improved.
Also, in silico created ssDNA probes using cslA gene for F. columnare identification should be tested. Nonetheless, as a control experiment we tested F. columnare amplicon on the LFA test created using F. branchiophilum 16S rRNA gene and saw no positive results indicating that in the future LFA test for F. branchiophilum species identification could be created.
Figure 6. Specificity experiment of F. columnare identification LFA test. Tests were evaluated using 100 nM of DNA in 100 μL of running buffer II. 1 - F. columnare asymmetric HDA with F_Col and R_Col primers, 2 - F. columnare symmetric HDA with F_Col and R_Col primers after denaturation, 3 - F. columnare asymmetric PCR with F_Col and R_Col primers, 4 - F. columnare symmetric PCR with F_Col and R_Col primers after denaturation, 5 - F. columnare asymmetric PCR with F_Psy and R_Psy primers, 6 - F. psychrophilum asymmetric PCR with F_Col and R_Col primers, 7 - F. piscis asymmetric PCR with F_Col and R_Col primers, 8 - E. coli asymmetric PCR with F_Col and R_Col primers, 9 - F. columnare asymmetric PCR with F_Col and R_Col primers on the test created for F. branchiophilum identification, 10 - no DNA template. CL indicates control line, TL - test line.
After testing specificity we aimed to determine the lowest amount of DNA detected by F. psychrophilum identification test (Video 1). To do this we used serial dilutions. As seen in a timelapse, the lowest amount of DNA detected was around 15 nM, because the test line was still visible. F. columnare LFA test showed similar results. This detection limit is sensitive enough to identify fragments amplified during HDA even if this amplification is not as efficient as PCR.
Video 1. Timelapse of F. psychrophilum LFA test (lower) and control (higher) lines development using serial dilutions of DNA. The starting amount was 500 nM followed by 250 nM, 125 nM, 62.5 nM, 31.25 nM, 15.63 nM, 7.81 nM, 3.91 nM, 1.95 nM, 0.98 nM, 0.45 nM, 0 nM.
Vilnius-Lithuania 2020 iGEM team results show that HDA-LFA based detection tool can be developed to identify specific Flavobacterium genus species. In the future further optimization must be performed to improve this detection tool. Optimizations using our onFlow software could help in improving test and control lines colour intensity as well as specificity. In addition onFlow will help in the process of creating a quantitative LFA. Also, to minimize wastage LFA with multiple test lines for different species identification could be created. In hopes that future iGEM teams will find our project useful and will try to improve it, all ssDNA probes can be found as DNA parts in iGEM repository.
References
- Strepparava, N., Wahli, T., Segner, H. et al. Detection and quantification of Flavobacterium psychrophilum in water and fish tissue samples by quantitative real time PCR. BMC Microbiol 14, 105 (2014)
- Kolm, C., Martzy, R., Führer, M. et al. Detection of a microbial source tracking marker by isothermal helicase-dependent amplification and a nucleic acid lateral-flow strip test. Sci Rep 9, 393 (2019).
contact us
follow us
