Loading menubar.....

Team:BJ101HS/Engineering



BBa_K3693000

Designed by: Ziyu Liu   Group: iGEM20_BJ101HS   (2020-09-12)

6 LTF 722aa

This gene is a member of the transferrin family of genes and its protein product is found in the secondary granules of neutrophils. The protein is a major iron-binding protein in milk and body secretions with an antimicrobial activity, making it an important component of the non-specific immune system. The protein demonstrates a broad spectrum of properties, including regulation of iron homeostasis, host defense against a broad range of microbial infections, anti-inflammatory activity, regulation of cellular growth and differentiation and protection against cancer development and metastasis. Antimicrobial, antiviral, antifungal and antiparasitic activity has been found for this protein and its peptides. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.



Sequence and Features

> Original sequence

atgaaacttgtcttcctcgtcctgctgttcctcggggccctcggactgtgtctggctggccgtaggagga
gtgttcagtggtgcgccgtatcccaacccgaggccacaaaatgcttccaatggcaaaggaatatgagaaaagtgcgtggccct
cctgtcagctgcataaagagagactcccccatccagtgtatccaggccattgcggaaaacagggccgatgctgtgacccttga
tggtggtttcatatacgaggcaggcctggccccctacaaactgcgacctgtagcggcggaagtctacgggaccgaaagacagc
cacgaactcactattatgccgtggctgtggtgaagaagggcggcagctttcagctgaacgaactgcaaggtctgaagtcctgc
cacacaggccttcgcaggaccgctggatggaatgtccctatagggacacttcgtccattcttgaattggacgggtccacctga
gcccattgaggcagctgtggccaggttcttctcagccagctgtgttcccggtgcagataaaggacagttccccaacctgtgtc
gcctgtgtgcggggacaggggaaaacaaatgtgccttctcctcccaggaaccgtacttcagctactctggtgccttcaagtgt
ctgagagacggggctggagacgtggcttttatcagagagagcacagtgtttgaggacctgtcagacgaggctgaaagggacga
gtatgagttactctgcccagacaacactcggaagccagtggacaagttcaaagactgccatctggcccgggtcccttctcatg
ccgttgtggcacgaagtgtgaatggcaaggaggatgccatctggaatcttctccgccaggcacaggaaaagtttggaaaggac
aagtcaccgaaattccagctctttggctcccctagtgggcagaaagatctgctgttcaaggactctgccattgggttttcgag
ggtgcccccgaggatagattctgggctgtaccttggctccggctacttcactgccatccagaacttgaggaaaagtgaggagg
aagtggctgcccggcgtgcgcgggtcgtgtggtgtgcggtgggcgagcaggagctgcgcaagtgtaaccagtggagtggcttg
agcgaaggcagcgtgacctgctcctcggcctccaccacagaggactgcatcgccctggtgctgaaaggagaagctgatgccat
gagtttggatggaggatatgtgtacactgcaggcaaatgtggtttggtgcctgtcctggcagagaactacaaatcccaacaaa
gcagtgaccctgatcctaactgtgtggatagacctgtggaaggatatcttgctgtggcggtggttaggagatcagacactagc
cttacctggaactctgtgaaaggcaagaagtcctgccacaccgccgtggacaggactgcaggctggaatatccccatgggcct
gctcttcaaccagacgggctcctgcaaatttgatgaatatttcagtcaaagctgtgcccctgggtctgacccgagatctaatc
tctgtgctctgtgtattggcgacgagcagggtgagaataagtgcgtgcccaacagcaacgagagatactacggctacactggg
gctttccggtgcctggctgagaatgctggagacgttgcatttgtgaaagatgtcactgtcttgcagaacactgatggaaataa
caatgaggcatgggctaaggatttgaagctggcagactttgcgctgctgtgcctcgatggcaaacggaagcctgtgactgagg
ctagaagctgccatcttgccatggccccgaatcatgccgtggtgtctcggatggataaggtggaacgcctgaaacaggtgttg
ctccaccaacaggctaaatttgggagaaatggatctgactgcccggacaagttttgcttattccagtctgaaaccaaaaacct
tctgttcaatgacaacactgagtgtctggccagactccatggcaaaacaacatatgaaaaatatttgggaccacagtatgtcg
caggcattactaatctgaaaaagtgctcaacctcccccctcctggaagcctgtgaattcctcaggaagtaa

>Sequence we use

gaattccatcatcaccaccaccacatgaaattggttttcttggttttgttgttcttgggtgctttgggtttgtgtttggctggtagaagaaga
tctgttcaatggtgtgctgtttctcaacctgaagctactaagtgttttcagtggcagagaaatatgagaaaggttagaggtcctccagtttc
ttgtattaagagagattcaccaattcaatgtatccaagctattgctgaaaacagagctgatgctgttactttggatggtggttttatctacg
aagctggtttggctccatacaagttgagaccagttgctgctgaagtttacggtactgaaagacaaccaagaactcattactatgctgttgct
gttgttaagaagggtggttcttttcaattgaatgaattgcaaggtttgaagtcctgtcatactggtttgagaagaactgctggatggaacgt
tccaattggtactttgagaccttttttgaattggactggtccaccagaaccaattgaagctgctgttgctagatttttttctgcttcttgtg
ttccaggagctgataagggtcaatttccaaacttgtgtagattgtgtgctggtaccggtgaaaataaatgtgctttctcttctcaagaacca
tatttttcttactctggtgcttttaagtgtttgagagatggtgctggtgatgttgcttttattagagagtctactgtttttgaagacttgtc
tgatgaagctgaaagagatgaatacgagttgttgtgtcctgataatactagaaagccagttgataagtttaaggattgtcatttggctagag
ttccatctcatgctgttgttgctagatctgttaatggtaaggaagatgctatttggaatttgttgagacaagctcaggaaaagtttggtaag
gataagtctccaaagttccaattgtttggttctccatctggtcagaaggatttgttgtttaaggattctgctattggtttttctcgtgttcc
accaagaattgattctggtttgtacttgggttctggttactttactgctattcaaaacttgagaaagtctgaggaagaagttgctgctagaa
gagctagagttgtttggtgtgctgttggtgaacaagaattgagaaagtgtaatcaatggtctggtttgtctgaaggatctgttacttgttcc
tctgcttctactactgaagattgtattgctttggttttgaagggtgaagctgatgctatgtctttggacggtggttacgtttatactgctgg
taagtgtggtttggttcctgttttggctgagaattacaagtctcagcaatcttctgatccagatccaaattgtgttgatagaccagttgaag
gttatttggctgttgctgttgttagaagatctgatacttctttgacttggaactctgttaagggaaagaagtcctgtcacactgctgttgac
agaactgctggttggaatattccaatgggtttgttgtttaatcagactggatcatgtaagtttgatgaatacttttctcagtcctgtgctcc
tggatctgatccaagatctaatttgtgtgctttgtgtattggtgacgaacagggtgaaaacaagtgtgttccaaactccaacgaaagatact
acggttacactggtgcttttagatgtttggctgaaaatgctggtgatgttgctttcgttaaggacgttacagttttgcaaaataccgatggt
aataacaacgaagcctgggctaaggatttgaagttggctgattttgctttgttgtgtttggatggtaagagaaagccagttactgaagctag
atcttgtcatttggctatggctccaaaccatgctgttgtttctcgtatggataaggttga
gagattgaagcaagttttgttgcatcaacaggctaagtttggtagaaacggttctgattgtcctgataagttttgtttgtttcaatctgaaa
ccaagaacttgttgtttaacgataacaccgagtgtttggctagattgcatggtaagactacttacgagaagtacttgggtccacaatacgtt
gctggtattactaacttgaagaagtgttccacttctcctttgttggaagcctgtgaatttttgagaaagcatcatcatcatcaccattaagc
ggccgc



BBa_K3693001

Designed by: Ziyu Liu   Group: iGEM20_BJ101HS   (2020-09-12)

5 CSN2 238aa

>Original Sequence

atgaaggtcctcatccttgcctgcctggtggctcttgctcttgcaagggagaccatagaaagcctgtcaagca
gtgaggaatctattacagaatacaagcagaaagttgagaaggttaaacatgaggaccagcagcaaggagaggatgaacaccaggat
aaaatctacccctctttccagccacagcctctgatctatccattcgttgaacctatcccctatggttttcttccacaaaacattct
gcctcttgctcagcctgctgtggtgctgcctgtccctcagcctgaaataatggaagtccctaaagctaaagacactgtctacacta
agggcagagtgatgcctgtccttaaatctccaacgatacccttttttgaccctcaaatcccaaaactcactgatcttgaaaatctg
catcttcctctgcctctgctccagcccttgatgcagcaggtccctcagcctattcctcagactcttgcacttccccctcagcccct
gtggtctgttcctcagcccaaagtcctgcctatcccccagcaagtggtgccctaccctcagagagctgtgcctgttcaagcccttc
tgctcaaccaagaacttctacttaaccccacccaccagatctaccctgtgactcag
ccacttgccccagttcataaccccattagtgtcTAA


>Sequence we use

gaattccatcatcaccaccaccacatgaaagttttgattttggcttgtttggttgctttggctttggctagag
aaactattgaatctttgtcttcctctgaagaatctattaccgaatacaaacaaaaggttgaaaaggttaagcatgaagatcagcag
caaggtgaggatgaacatcaagataaaatttatccatccttccaaccacaaccattgatttacccattcgttgaaccaattccata
cggttttttgccacagaacattttgccattggctcagccagctgttgttttgccagttccacaaccagaaattatggaagttccaa
aggctaaggatactgtttataccaagggtagagttatgcctgttttgaagtctccaactattcctttttttgatccacagattcca
aagttgactgatttggaaaacttgcatttgccattgcctttgttgcagcctttgatgcaacaggttccacaacctattcctcaaac
cttggctttgcctccacagccattgtggtctgttcctcaacctaaggttttgccaattcctcaacaggttgttccttacccacaga
gagctgttcctgttcaagctcttttgttgaaccaggaattgttgttgaatcctactcatcaaatttacccagttactcaacctttg
gctccagttcataacccaatctccgt
tcaccatcatcatcaccattaagcggccgc



BBa_K3693002

Designed by: Ziyu Liu   Group: iGEM20_BJ101HS   (2020-09-12)

4CSN3 194aa

CSN3 encodes the protein Kappa-casein, which stabilizes micelle formation, preventing casein precipitation in milk. Kappa-casein is an important part of the proteins in the human milk, so we find the encoded genes in order to produce those proteins.

Sequence and Features

Original sequence

atgaagagttttcttctagttgtcaatgccctggcattaaccctgccttttttggctgtggagg
ttcaaaaccagaaacaaccagcatgccatgagaatgatgaaagaccattctatcagaaaacagctccatatgtccca
atgtattatgtgccaaatagctatccttattatggaaccaatttgtaccaacgtagaccagctatagcaattaataa
tccatatgtgcctcgcacatattatgcaaacccagctgtagttaggccacatgcccaaattcctcagcggcaatacc
tgccaaatagccacccacccactgtggtacgtctcccaaacctgcatccatcatttattgccatccccccaaagaaa
attcaggataaaataatcatccctaccatcaataccattgctactgttgaacctacaccagctcctgccactgaacc
aacggtggacagtgtagtcactccagaagctttttcagagtccatcatcacgagcacccctgagacaaccacagttg
cagttactccacctacggcataa

>sequence we use

gaattccatcatcaccaccaccacatgaaatcttttttgttggttgttaacgctttggctttgaccttgc
catttttggctgttgaagttcaaaaccaaaaacaaccagcttgtcacgaaaacgacgaaagacctttttaccaaaagactgct
ccatacgttccaatgtattacgttccaaactcttacccttactatggtactaatttgtaccagagaagaccagctatcgctat
taacaacccatacgttcctagaacctactacgctaacccagctgttgttagaccacatgctcaaattcctcaaagacagtatt
tgccaaactcccacccaccaaccgttgttagattgccaaacttgcacccatccttcattgctattccaccaaaaaagattcaa
gataagattattattccaactattaacactattgctactgttgaaccaactccagctccagctactgaaccaactgttgattc
tgttgttactccagaagccttttctgaatctattattacttctactccagaaactactactgttgctgttactccaccaactg
ctcatcatcatcatcatcattaagcggccgc




BBa_K3693003

Designed by: Ziyu Liu   Group: iGEM20_BJ101HS   (2020-09-12)

7 LALBA 154aa

This gene encodes alpha-lactalbumin, a principal protein of milk. Alpha-lactalbumin forms the regulatory subunit of the lactose synthase (LS) heterodimer and beta 1,4-galactosyltransferase (beta4Gal-T1) forms the catalytic component. Together, these proteins enable LS to produce lactose by transfering galactose moieties to glucose. As a monomer, alpha-lactalbumin strongly binds calcium and zinc ions and may possess bactericidal or antitumor activity. A folding variant of alpha-lactalbumin, called HAMLET, likely induces apoptosis in tumor and immature cells. [provided by RefSeq, Jul 2008]

Sequence and Features

> Original sequence

Atgaggttctttgtccctctgttcctggtgggcatcctgttccctgccatcctggccaagcaattcacaaaatgtgagctgtcc
cagctgctgaaagacatagatggttatggaggcatcgctttgcctgaattgatctgtaccatgtttcacaccagtggttatga
cacacaagccatagttgaaaacaatgaaagcacggaatatggactcttccagatcagtaataagctttggtgcaagagcagcc
aggtccctcagtcaaggaacatctgtgacatctcctgtgacaagttcctggatgatgacattactgatgacataatgtgtgcc
aagaagatcctggatattaaaggaattgactactggttggcccataaagccctctgcactgagaagctggaacagtggctttg
tgagaagttgtga

>Sequence we use

pclass="bodytext">gaattccatcatcaccaccaccacatgagattttttgttccattgtttttggttggtatcttgtttcctg
ctattttggctaagcaatttactaagtgtgaattgtctcaattgttgaaggatattgatggatacggtggtattgctttgcct
gagttgatttgtactatgtttcatacttctggttacgatactcaagctattgttgaaaacaacgaatctactgaatacggttt
gtttcaaatttctaacaagttgtggtgtaagtcttctcaggttcctcaatccagaaacatttgtgatatttcttgtgacaagt
tcttggatgacgatattactgatgatattatgtgtgctaagaagattttggatattaagggtattgactactggttggctcat
aaggctttgtgtactgagaagttggagcaatggttgtgtgaaaagttgcatcaccatcatcaccattaagcggccgc



BBa_K3693004

Designed by: GaoJie   Group: iGEM20_BJ101HS   (2020-09-12)

CSN3 + α-secretion signal

For secreting the k-casein outside yeast

The composite part consists of a secretion signal for pichia pastoris that can trigger the expression of the protein exerted in, and followed by a his tag for purification, then the sequence of CSN3 we exerted in. This sequence enables the yeast to produce kappa-casein and secrete it outside.



BBa_K3693005

Designed by: GaoJie   Group: iGEM20_BJ101HS   (2020-09-12)

LTF + α-secretion signal

For secreting the lactoferrin outside yeast

The composite part consists the a secretion signal E.coli that can trigger the expression of the protein exerted in, and the sequence of LTF we exerted in. This sequence enables the bacteria produce lactotransferrin.



BBa_K3693007

Designed by: GaoJie   Group: iGEM20_BJ101HS   (2020-09-12)

CSN2 + α-secretion signal

Expression of CSN2 in E.coli

The composite part consist the a secretion signal E.coli that can trigger the expression of the protein exerted in, and the sequence of CSN2 we exerted in. This sequence enables the bacteria produce beta casein.



BBa_K3693007

Designed by: GaoJie   Group: iGEM20_BJ101HS   (2020-09-12)

LALBA + α-secretion signal

Expression of LALBA

The composite part consists the a-secretion signal E.coli that can trigger the expression of the protein exerted in, and the sequence of LALBA we exerted in. This sequence enables the bacteria produce lactalbumin alpha.



BBa_K3693008

Designed by: GaoJie   Group: iGEM20_BJ101HS   (2020-09-12)

LTF + 6xHis tag

Purification of LTF

This composite part consists the gene and the 6xHIS tag located before and after the LTF. 6xHIS allows Ni-NTA to recognize and bring out the 6xHIS and the lactoferrin it is holding, enabling the extraction of the lactotransferrin from the system.



BBa_K3693009

Designed by: GaoJie   Group: iGEM20_BJ101HS   (2020-09-12)

CSN2 + 6xHIS tag

Purification of CSN2

This composite part consists the gene and the 6xHIS tag located before and after CSN2. 6xHIS allows Ni-NTA to recognize and bring out the 6xHIS and the protein it is holding, enabling the extraction of the beta-casein from the system.



BBa_K3693010

Designed by: GaoJie   Group: iGEM20_BJ101HS   (2020-09-12)

CSN3 + 6xHIS tag

Purification of CSN3

This composite part consists the gene and the 6xHIS tag located before and after CSN3. 6xHIS allows Ni-NTA to recognize and bring out the 6xHIS and the protein it is holding, enabling the extraction of the k-casein from the system.



BBa_K3693011

Designed by: GaoJie   Group: iGEM20_BJ101HS   (2020-09-12)

LALBA + 6xHIS tag

Purification of LALBA

This composite part consists the gene and the 6xHIS tag located before and after LALBA. 6xHIS allows Ni-NTA to recognize and bring out the 6xHIS and the protein it is holding, enabling the extraction of the lactalbumin from the system.