Construction of ammonia metabolic pathway
Construction of plasmids pBR322-KanR-pTac-argA and pBR322-KanR-pTac-argA ^ fbr;
Knockout the argR gene in E.coli DH10b;
Transfer pBR322-KanR-pTac-argA and pBR322-KanR-pTac-argA ^ fbr to E.coli DH10b ΔargR;
Culture preservation
Week One (20200627-20200628)
ArgA wild-type was amplified from E.coli DH10b genome by PCR and connected to pSB1C3.
20200627
| Name of clone | DH10B{pSB1C3-argA_EcoWT} | pSB1C3-argA_EcoWT.dna |
|---|---|---|
| strain source | argA From DH10B pSB1C3 From Bluephalab | pSB1C3-fwYellow.dna |
| Methods | PCR， Enzyme digestion and Ligase |
The strain DH5 containing plasmid pSB1C3 was cultured
| Marked | pSB1C3-HFI | ||
|---|---|---|---|
| Strain | DH5α{pSB1C3-FwYellow} | ||
| Resistance | Chl (Cm) | ||
| Culture Condition： | shaking tables | 37 ℃ | 200 rpm |
20200628
Preserve cultured strain DH5α containing plasmid pSB1C3-FwYellow for later use.
| Strain preservation 001 | |
|---|---|
| Label name | HFI001 |
| Source bacterial solution | 1 |
| Preservation method | 50% glycerol solution 1: 1 miscible, stored at -80 ℃ |
| Name of preservation | DH5α{pSB1C3-FwYellow} |
Extraction of plasmid pSB1C3-FwYellow from DH5α
| Product Name | HFI001 6.28 | ||||
|---|---|---|---|---|---|
| Source bacterial solution | 1 | ||||
| Plasmid name | pSB1C3-fwYellow | ||||
| Extraction method | Rapid Extraction Kit | Sample | 2 | mL | |
| Eluate | ddH2O | Elution volume | 50 μL | concentration | 121.4 ng/μL |
Excision of the yellow protein gene fragment from the plasmid pSB1C3-FwYellow
| Label name | HFI | |||
|---|---|---|---|---|
| Substrate DNA | pSB1C3-fwYellow | |||
| Total volume | 50 μL | Substrate amount | 10 | μL |
| Endonase (separated by semicolons) | EcoRI;SpeI | |||
| Buffer | NEB Cutsmart | temperature | 37 ℃ | |
| Reaction duration | 60 min | Is it inactivated? | Yes. | |
| Expected product length | 1.1 kb;2.0 kb” |
Amplify the original ArgA gene from DH10b
| Label name | argA | |||
|---|---|---|---|---|
| Template source | DH10b | |||
| Primer (separated by semicolons) | argA-F1;argA-R1 | |||
| Total volume | 50 μL | |||
| Polymerase type | FastPfu | Template Quantity | Colony | |
| Annealing temperature | 55 ℃ | Extension time setting | 30 s | |
| Expected product length | 1.3 | kb |
Verify the proposed ArgA gene (validated correctly)
| Agarose gel electrophoresis 005 | |||
|---|---|---|---|
| Concentration | 0.01 | Marker | Trans8K Genestar 2000 |
| Voltage | 130 V | Time | 25 min |
| Sample loading | 6 μL | ||
| Layout description | Lane1:PCR004; Lane2:003; Lane3:pSB1C3-fwYellow; Lane4:2K Marker; Lane5: Trans8K |
Week Two (20200629-20200705)
Construction of argA fbr
Sequencing
20200629
To retrieve the remaining ArgA gene.
| Product Name | argA | ||
|---|---|---|---|
| Sample Source | 0628【15:00】argA | ||
| Extraction method | Tiangen universal DNA recovery kit | ||
| Elution volume | 50 μL | concentration | 38.4 ng/μL |
| Remarks | Store the recovered product in 4 degree refrigerator blue board |
20200630
Modify the ArgA gene to have the same sticky end as the plasmid.
| Enzyme digestion 007 | ||||
|---|---|---|---|---|
| Label name | F-HFI | |||
| Substrate DNA | DNA fragment recovery 006 | |||
| Total volume | 50 μL | Substrate amount | 25 | μL |
| Endonase (separated by semicolons) | EcoRI;SpeI | |||
| Buffer | NEB Cutsmart | temperature | 37 ℃ | |
| Reaction duration | 60 min | Is it inactivated? | 是 | |
| Expected product length | 1.3kb | |||
| Remarks | After digestion and inactivation, directly used for T4 link |
20200701
The product mixture was obtained by linking ArgA gene with plasmid digestion system by PCR.
| T4 Connection 008 | |||
|---|---|---|---|
| Label name | 1C3-argA | ||
| Total system | 20 | μL | |
| Fixed component (automatic calculation) | |||
| 10× T4 ligase buffer | μL | ||
| T4 ligase | μL | ||
| 0630 F-HFI | 2 | μL | No resistance |
| 0628 HFI （vector) | 1 | μL | Resistance marker |
| ddH2O | 14 | μL | Phosphorylated fragment |
The product mixture was transferred into receptive cells, cultured, and unluminescent positive monoclones were found and cultured.
| Tablet Name | pSB1C3-argA_EcoWT | ||
|---|---|---|---|
| Transform DNA sources. | T4 Link 008 | ||
| DNA addition | 10 | μL | |
| Sensitive cell | EPS300 | ||
| Sensitive state usage | 50 | μL | |
| Resuscitation medium | LB | 300 | μL |
| Coated plate | 9 cm板 | LB | |
| Resistance marker | Chl | ||
| Coating amount | After centrifugation | ||
| Remarks | Negative clone with fluorescence |
20200702
| Inoculation 010 | ||||
|---|---|---|---|---|
| Name of bacteria | 0701 transform to 009 | |||
| Resistance (multiple) | Chl (Cm) | |||
| From: | LB colony plate | Take: | 3 | Colony |
| Dilute to | 5 | mL | LB Liquid | Test tube |
| Culture conditions: | Shaker | 37 ℃ | 200 rpm | |
| Remarks | For plasmid extraction |
Colony PCR, replication positive monoclonal
| TaqMixPCR011 | ||||
|---|---|---|---|---|
| Template source | Inoculation 010 | |||
| Primer (separated by semicolons) | F; 2R | |||
| Template quantity (each) | 1 | Colony | ||
| Number of repackaged tubes (about 0.5 more tubes are recommended than expected): | 6 | Volume per tube | 20 | μL |
| Total system preparation (automatic calculation): | ||||
| Total preparation | 120 | μL | ||
| 2×Taq Mix | 60 | μL | ||
| Primer 1 | 6 | μL | ||
| Primer 2 | 6 | μL | ||
| ddH2O | 48 | μL | ||
| Annealing temperature | 55 ℃ | Extension time setting | 100 s | |
| Expected product length | 1.6 | kb |
20200703
Extraction of plasmid
| Plasmid extraction 012 | |||||
|---|---|---|---|---|---|
| Product Name | EC3-ArgA 1 ~ 3 | ||||
| Source bacterial solution | Inoculation 010 | ||||
| Plasmid name | ArgA | ||||
| Extraction method | Rapid Extraction Kit | Sample | 2 | mL | |
| Eluate | ddH2O | Elution volume | 50 μL | concentration | 100 ng / μL |
| Remarks | Concentration measurement for nanoDrop |
20200704
Using PCR mutant plasmids
| Label name | F1 F2 V1 V2 | |||
|---|---|---|---|---|
| Template source | Plasmid Extraction 012 pSE-EC3-ArgA | |||
| Primer (separated by semicolons) | ||||
| Total volume | 50 μL * 4 | |||
| Polymerase type | FastPfu | Template Quantity | 50 | of |
| Annealing temperature | 65 °C/55 ℃ | Extension time setting | 70s/40s | |
| Expected product length | 2.3/1·.2 | kb |
Verify mutant plasmid amplification size (correct)
| Agarose gel electrophoresis 014 | |||
|---|---|---|---|
| Concentration | 0.01 | Marker | Genestar 2000 |
| Voltage | 130 V | Time | 25 min |
| Sample loading | 5 μL | ||
| Layout description | Lane1: High Fidelity PCR 013F2; Lane2: High Fidelity PCR 013F1; Lane3: High Fidelity PCR 013V2; Lane4: High Fidelity PCR 013V1; Lane5: 5K Marker |
| DPN I template digestion 015 | |||
|---|---|---|---|
| Label name | F1 F2 V1 V2 | ||
| Total system | 50 | μL | |
| Fixed component (automatic calculation) | |||
| 10x Cutsmart buffer | 4.5 | μL | |
| DPN I | 0.5 | μL | |
| PCR products | 45 | μL | Resistance marker |
Recycling
| DNA Fragment Recovery 016 | |||
|---|---|---|---|
| Product Name | F | ||
| Sample Source | 20200704 Agarose gel electrophoresis 014 Lane 1 and 2 | ||
| Extraction method | Tiangen universal DNA recovery kit | ||
| Elution volume | 30 μL | Detection concentration | of / μL |
| Remarks | Mix F1 F2 |
Ligase
| GA018 | |||
|---|---|---|---|
| Label name | G1 G2 | ||
| Gibson premix | 10 μL | Type | 2× |
| Assemble Fragments: | |||
| DNA Fragment Recovery 016 | 3 | μL | No resistance |
| DNA Fragment Recovery 017 | 2 | μL | Resistance marker |
| Remarks |
| Transformation 019 | Chemical conversion method | ||
|---|---|---|---|
| Tablet Name | G1 7.4 HFI 、 G2 7.4 HFI | ||
| Transform DNA sources. | 20 | ||
| DNA addition | 10 | μL | |
| Sensitive cell | DH5α Commercial Feeling State | ||
| Sensitive state usage | 50 | μL | |
| Resuscitation medium | LB | 200 | μL |
| Coated plate | 9 cm board | LB | |
| Resistance marker | Cm | ||
| Coating amount | Full coating |
20200705
Colony PCR and agarose gel electrophoresis to verify the product is correct
Sequencing
Week Three (20200706-20200712)
Preservation of DH5a (pSB1C3-argAfbr) and extraction of plasmid pSB1C3-argAfbr;
Construction of plasmids pBR322-KanR-pTac-argA and pBR322-KanR-pTac-argA fbr
Week Four (20200713-20200719)
Knockout argR gene in Nissle strain
Construction of plasmid pTargetA-fimA gRNA1/2-Arm-(UP&DOWN)
Design Information
gRNA Design website：https://www.atum.bio/eCommerce/cas9/results?multipleContacts=false
| Name | gRNA sequence |
|---|---|
| gRNA1 | agaagagaaatttagctccc |
| gRNA2 | gaagagaaatttagctccca |
Primers needed to construct pT plasmids：
| Primers | Squence |
|---|---|
| 0622-pTarget-VF | aagcttagatctattaccctgttatcc |
| DOWN-Arm-F | accaccatatcgggtgactttctctgccccgtcgcttctg |
| DOWN-Arm-R | cagggtaatagatctaagcttgccacaccacttacggatacg |
| pTarget-JC-F | ttgctggccttttgctcacatg |
| pTarget-JC-R | tcgatcatagcacgatcaacggc |
| pTarget-VR | actagtattatacctaggactgagct |
| UP-Arm-F | tctctagagtcgacctgcagggtttttaacagtagtgcaagcgc |
| UP-Arm-R | aagtcacccgatatggtggttg |
| gRNA1-F1 | taatactagtagaagagaaatttagctcccgttttagagctagaaatagcaagttaaaa |
| gRNA1-F2 | cagtcctaggtataatactagtagaagagaaatttagctcccgttttag |
| gRNA2-F1 | taatactagtgaagagaaatttagctcccagttttagagctagaaatagcaagttaaaa |
| gRNA2-F2 | cagtcctaggtataatactagtgaagagaaatttagctcccagttttag |
| Scaffold-R | ctgcaggtcgactctagaga |
| genome-F | ctggagcgatatcatacagagagagttc |
| genome-R | gttcagcatttcacgcatatccattggc |
Week Five (20200720-20200726)
Preparation of Nissle competent cells
The plasmids pCas was transformed into competent cell
Inoculate pCas-Nissle, ready to make Nissle -pCas competent cell
Week Six (20200727-20200802)
pT was transformed into Nissle -pCas, and verify whether to knock out argR;
Debug:The transformation efficiency was too low,so it was necessary to reprepare Nissle -pCas competent cell.
Week Seven (20200803-20200809)
Repeat the work of the previous week: Failure
Week Eight (20200810-20200816)
Debug: Replace Nissle with E.coli DH10b, make competent cell;
The plasmids pCas was transformed into competent cell
Inoculate pCas-DH10b, ready to make DH10b -pCas competent cell
Week Nine (20200817-20200823)
pT was transformed into Nissle -pCas, and verify whether to knock out argR: succeed
The plasmid pBR322-KanR-pTac-argA and pBR322-KanR-pTac-argA fbr were transferred into DH10b -ΔargR
Culture pres
Construction of hydrogen sulfide metabolic pathway
Replication of cysE gene from DH5a genome
Construction of plasmids pBR322-KanR-pTac-cysE-Mut (including cysE-5, cysE-256, cysE-11-2, cysE-5-11-2，cysE-256-11-2，cysE-256-5，cysE-256-5-11-2），respecrively.
Transforming pBR322-KanR-pTac-cysE-mut into Nissle competent cell.
Culture preservation
Week One (20200713-20200719)
cysE wild-type was amplified from E.coli DH15 α genome by PCR and connected to plasmid pTYT.
Sequencing
Week Two (20200720-20200726)
Construction of plasmids pBR322-KanR-pTac-cysE-5，pBR322-KanR-pTac-cysE-256，pBR322-KanR-pTac-cysE-11-2，
pBR322-KanR-pTac- cysE-5-11-2；
Sequencing
Week Three(20200727-20200802)
Construction of plasmids pBR322-KanR-pTac-cysE-256-11-2，pBR322-KanR-pTac-cysE-256-5，pBR322-KanR-pTac-cysE-256-5-11-2；
Sequencing
Week Four (20200803-20200809)
Preparation of Nissle competent cell;
Plasmids pBR322-KanR-pTac-CysE-mut was transferred into Nissle competent cell, respectively.
After verification, the strain was preserved.
Myrcene metabolic pathway
Synthesize the gene MS
Construction of plasmid pBR322-KanR-pTac-RBS-GPPS-RBS-MS;
Transforming plasmid pBR322-KanR-pTac-RBS-GPPS-RBS-MS into DH10b-pMevT-pMBIS competent cell;
After verification, the strain was preserved.
Week One (20200810-20200816)
MS gene was synthesized by GenScript
Construction of plasmid pBR322-KanR-pTac-RBS-GPPS-RBS-MS;
Week Two (20200817-20200823)
Preparation of DH10b-pMevT-pMBIS competent cell;
After verification, the strain was preserved.
Functional testing:
Week Seven (20200824-20200830)
Test method：https://2020.igem.org/Team:GZ_HFI/Method