Team:ZJU-China/Improve
Improvement
Overview
T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase, since discovered, it has been inserted into various vectors to express specific proteins in prokaryotic systems. This year, we chose BBa_I712074 which is labelled as a T7 promoter to improve its expression efficiency with the help of previous research[1]. For the T7 promoters all have a conserved sequence, we created mutations at the same points on BBa_I712074 as we learned from the research. Therefore, several specific mutants were made to improve the transcription strength of BBa_I712074.
As our mutants were site-specific, we synthesized these mutant DNA sequence from a synthetic company directly (SUNYA, Zhejiang, CN). To test the function of mutant promoters, EGFP was chosen as our reporter gene, adding a ribosome binding site at the front to ensure protein expression. E.coli BL21 (DE3) was selected as the chassis to produce EGFP, which can lysogenically express the T7 RNA polymerase with the induce of IPTG.
Result
Our part_EGFP vectors were successfully constructed and the sequence results were correct. E.coli BL21 (DE3) was cultured in LB medium until the OD600 reached 0.6, we added 1 mM of IPTG to induce the expression of EGFP at 30℃ for 20 h. By assessing the absolute fluorescence and OD600, we can conclude the relative strength of all promoters. Finally, we screened out three mutants with higher intensity.
Figure 1. Strength of wildtype T7 promoter and mutant promoters. Relative fluorescent intensity is standardized with fluorescence (excitation wavelength: 485 nm; detection wavelength: 528 nm) per OD600. The intensity of the four mutants was higher than that of the wild type.
| Part Number | Sequence (+11~+35) |
|---|---|
| BBa_I712974(WT) | TATAATACGACTCACTATAGGGAAT |
| BBa_K3398000 | TATAATACGACTCACATTGGGGAAT |
| BBa_K3398001 | TATAATACGACTCGGTATAGGGAAT |
| BBa_K3398002 | TATAATGCGACTCACTATAAGGAAT |
Table 1. Sequence of WT and Enhanced Promoters
Protocol
1. Linearize pSB1c3 plasmid by PCR.
(F: TACTAGTAGCGGCCGCTGCAG, R: CTCTAGAAGCGGCCGCGAATTC)
2. Obtain the RBS+EGFP sequence and part sequence by PCR.
(F: aaagaggagaaatactagATGAGCAAGGGC, R: TTACTTGTACAGCTCGTCCATG)
3. Use homologous recombination to construct the partX_EGFP pasmid.
4. Transform the recombination plasmids into E.coli DH5α, then pick the positive clones and sequence.
5. After recombinational sequence results were comfirmed, transform the plasmids into E.coli BL21 (DE3).
6. Coat the transformed BL21 onto the plate added 1 mM IPTG.
7. Incubate at 37℃ and observe colony color under the blue light to see if the EGFP is expressed.
8. Pick greener single colonies, add them into 1 mL LB, incubate at 37℃ in a shaker for 6–8 h till the OD600 reach 0.6.
9. Add the whole germ solution from last step into 5 mL LB, add IPTG to 1 mM and induce for 12 h at 30℃.
10. Measure the fluorescence (excitation wavelength: 485 nm; detection wavelength: 528 nm) and OD600.
References
[1]. Komura, R., Aoki, W., Motone, K., Satomura, A., & Ueda, M. (2018). High-throughput evaluation of T7 promoter variants using biased randomization and DNA barcoding. PloS one, 13(5). https://doi.org/10.1371/journal.pone.0196905
