Team:Grenoble Alpes/Experiments

Experiments

PyoBusters is a genetically engineered E. coli strain, fulfilling a therapeutic action against P. aeruginosa and its biofilm. Our PyoBusters system works thanks to a plasmid comprising 4 different sets of genes, as well as a gene inserted in the genome.

Those sets of genes can be separated into 3 systems, operating in parallel with different objectives.

• Survival system: Specifically target the P. aeruginosa’s biofilm to grow on its surface.
• Therapeutic system: Produce intracellular therapeutic molecules to destroy P. aeruginosa and its biofilm.
• Delivery system: Work as a delivery system allowing the in-situ release of therapeutic molecules.

WetLab Introduction

Before starting the experiments, we used Benchling and UTR Designer for respectively building our plasmid constructions and designing the DNA sequences. Indeed, UTR Designer is a web site able to provide different 5’UTR sequences for a specific gene and estimate with a score their translational strength.
To simplify the insertions of these 5’UTR sequences, we had them synthesized following the respective promoters by IDT. In order to differentiate the different strengths of 5’UTR sequences we added an adjective (high or low) or a percentage of relative expression followed by the noun of the gene for which it was designed.

To standardize the cloning strategy we chose to work with pUCBB. This plasmid contains restriction sites shown in the illustration 1 that were used to insert specific parts. For example, all the promoters were cloned between Xbal and Ndel and all the genes were cloned between Ndel and Nsil. For the terminators, we used two different approaches; we cloned them either between Nsil and Xhol if the next slot was used or Nsil and Spel if not.
Sequences were previously amplified by PCR with primers that permit to add the respective restriction enzyme sites and then have been digested.
All the constructions were checked by digestion and PCR to validate them. All the constructions were made in E. coli DH5 α.

Figure 1 represents the different restriction sites contained in the plasmid pUCBB and the cloning strategy used to insert promoters, genes and terminators.

Survival system

1. Selection of the strongest promoter to produce the RhlR protein

So that our system is as sensitive as possible to BHL, we needed to have the highest production of rhlR in the engineered E. coli strain. Thus, we tested three constitutive promoters with different strengths found in the iGEM Bank: J23100, J23102 and J23106. To identify the strongest one, we integrated the promoters into pUCBB-eGFP and transformed E. coli DH5 α strains.

Figure 2 representing the part BBa_K3463006

Figure 3 representing the part BBa_K3463004

Figure 4 representing the part BBa_K3463005

From this step, we monitored both the fluorescence and the absorbance of the bacterial cultures (transformed E. coli DH5 α). Indeed, we quantified the level of expression of eGFP over time for the different constructions in order to select the strongest promoter. Then, we replaced the reporter gene by the rhlR gene to build the pUCBB-J13100-RhlR BBa_K3463007. To finish, we added the terminator B0015 behind rhlR BBa_K3463008.

Figure 5 representing the part BBa_K3463008

2. Inducible promoter rhlR (PRhlR)

The coding sequence for the inducible promoter RhlR comes from the IGEM Bank BBa_K1949060. This promoter is activated by the presence of BHL via the formation of a BHL/RhlR complex. Indeed, it is known that the binding of the BHL/RhlR complex on PrhlR can trigger specific downstream genes. Thus, before using this sequence in the final system, we wanted to ensure that PrhlR couldn't trigger the transcription of the downstream gene without its specific transcriptional activator RhlR. Therefore, we cloned this promoter into the plasmid pUCBB with the reporter gene eGFP in E. coli Nissle strain BBa_K3463011.

Figure 6 representing the part BBa_K3463011

We chose this particular E. coli strain because it hasn’t any endogenous production of RhlR. Thus, with or without BHL in the medium, PrhlR shouldn’t be activated and no eGFP should be produced. So, we monitored the fluorescence of the bacterial cultures to quantify the expression of eGFP over time in absence or in presence of 100µM of BHL in the medium. The construct will be validated only if no fluorescence is detected in both conditions.

3. BHL sensing

Thanks to the Standard Assembly technique, the two previous parts described above were cloned in the same vector to obtain the plasmid pUCBB-J23100-RhlR-B0015-PrhlR-eGFP BBa_K3463019.

Figure 7 representing the part BBa_K3463019

Indeed, by digesting J23100-RhlR-B0015 BBa_K3463008 with EcoRI/SpeI, PrhlR-eGFP BBa_K3463011 with XbaI/PstI and the backbone pUCBB with EcoRI/PstI, we built a new part able to both produce RhlR and sense BHL.
Therefore, 6 bacterial cultures of transformed E. coli Nissle were set up with an increasing amount of synthetic BHL : 100µM / 10µM / 1µM / 100nM / 10nM / without BHL. In addition, a culture of wild type E. coli Nissle was used as negative control.
The purpose of this experiment was to evaluate the correlation between the BHL concentration in the medium and the intensity of the fluorescence emitted. From this step, the same construction with eGFP replaced by the LacI gene can be built.

4. Ptac construction and verification

In order to integrate the “validation” lysis system into the genome, we built two different plasmids. Both contain the eGFP gene followed by the terminator B0017 between NsiI and XhoI (leaving an emplacement for the future genomic insertion procedure) from the iGEM Bank and either the promoter Ptac_High or Ptac_Low.

Figure 8 representing the part BBa_K3463018

Figure 9 representing the part BBa_K3463017

To ensure that the 5’UTR selection and terminator B0017 were relevant, we monitored the eGFP expression of the four constructions in E. coli DH5 α. We measured both the fluorescence and the absorbance of the bacterial culture for 4 to 5 hours of the construction Ptac_High-eGFP, Ptac_Low-eGFP, Ptac_High-eGFP-B0017, Ptac_Low-eGFP-B0017, and a non-transformed strain as a negative control.
This experiment was initially planned for constructions integrated into the genome. However due to a lack of time and a technical issue, the experience was made with plasmid constructions.

5. Genomic integration of the constructions

The genomic integration was made following the Datsenko et al. protocol (https://doi.org/10.1073/pnas.120163297 ) adjusted in order to fit our needs as described in the illustration.

Figure 10 representing the plasmids PKD3, PKD46, and PKD20 were used respectively to:
(i) enable the selection of the recombinant clone
(ii) make the recombination
(iii) eliminate the resistance gene

Initially, the integration protocol was carried out without using the resistance gene to limit the use of antibiotics and avoid the creation of strain carrying a resistance gene into its genome. This approach was proved ineffective.
Consequently, the protocol was carried out following the initial protocol as described in the following figure. Schéma The PKD3 chloramphenicol gene resistance flanked by the 2 FRTsites, was amplified by PCR and added to the Plasmid pUCBB-Ptac_High-eGFP-B0017 or Ptac_Low-eGFP-B0017 between the restriction sites XhoI and SpeI.
The overall constructs that needed to be integrated into the genome namely pUCBB-Ptac_High/_Low-eGFP-B0017 were then unsuccessfully amplified by PCR. Due to the lack of time, we conceived a new experiment to overcome this issue.

6. Proof of concept construction

To get a proof of concept for our entire genetic circuit, we decided to build a plasmid containing all the parts of the survival system:

• J23100-RhlR-B0015 BBa_K3463008
• PrhlR-LacI BBa_K3463031
• Ptac-eGFP-B0017 BBa_K3463018

Figure 11 representing the part BBa_K3463020

Then, we transformed a E. coli BL21 strain with BBa_K3463020 and monitored the expression of the eGFP by measuring the fluorescence with an increasing amount of synthetic BHL : 100µM / 10µM / 1µM / 100nM / without BHL. In addition, a culture of wild type E. coli BL21 was used as negative control.

GO TO RESULTS

GO TO DESIGN

Therapeutic system

1. Parts extraction and constructions

To deliver the therapeutics molecules to the biofilm of P. aeruginosa, we transformed the engineered E. coli BL21 with the necessary genes.

We got the Dispersin B (DspB) from the part BBa_K1659200, designed by Wei Chung Kong iGEM15_Oxford15 (2015-08-28).

The Alginate lyase (AlgL, BBa_K3463002) and the Pyocin S5 (PyoS5, BBa_K3463001) have been extracted from the PAO1’s genome. To do so, a kit of DNA extraction was used to lyse PAO1.

We used the plasmid pUCBB containing the J23100 promoter (pUCBB-J23100-eGFP) because we had characterized it by ourselves. The Dispersin B, Pyocin S5 and Alginate lyase were cloned inside instead of the rapporter gene in E. coli DH5α. Unfortunately, it went wrong for both Pyocin S5, and Alginate lyase. Thus, we decided to clone them in the pUCBB-ntH6-eGFP containing a stronger promoter than J23100.

Figure 12 representing the part BBa_K3463001

Figure 13 representing the part BBa_K1659200

As soon as we obtained the plasmid pUCBB-ntH6-PyoS5 and pUCBB-J23100-DspB, we transformed each of them in E. coli BL21 to optimize protein expression.

2. Creation of Pseudomonas aeruginosa’s biofilm

To test our therapeutics molecules on the PAO1's biofilm, we decided to create a biofilm on a 96-wells plate. We started a preculture that grew overnight. The next day, we inoculated a 96-well plate and incubated for 20 hours at 30°C. Nevertheless, we didn’t manage to create this biofilm in our laboratory. From this step, we decided to contact our two partners (Bioaster and I&L Biosystems) to produce the PAO1’s biofilm and test our therapeutic molecules in their laboratories.

3. Protein expression, extraction and storage

In our system, the engineered E. coli should lysate itself to deliver the therapeutics molecules. In order to test these two therapeutics molecules (Pyocin S5 and Dispersin B) on P. aeruginosa and its biofilm, we needed to produce and extract them from E. coli BL21. For each growing culture, we started the lysis protocol when the OD reached 0,9. After sonication, all the samples of bacterial lysis cultures were stored at -80°C in a glycerol buffer.

4. Tests on PAO1

As we didn’t manage to create the PAO1’s biofilm in our laboratory, we sent our therapeutic molecules for testing to Bioaster.
According to the article A steam-based method to investigate biofilm[1], they use a steam washing concept. This technique allows the removal of planktonic bacteria without altering the biofilm in contrast to pipette-based washing. They grow biofilms in a 96-well plate, with a cooling system, which is held upside down above a boiling system. The steam gently washes biofilms and removes planktonic bacteria.

Concerning the quantification of the biofilm, they use the resuspension of the biofilm in phosphate-buffered saline instead of dye staining which can be toxic. They realised successive dilutions until 10^-10 and spoted 10µL of each dilutions in COS geloses to assess the CFU/mL per replicate.

The tested conditions were:

• Lysis Buffer (used to obtain the E. coli lysates)
• Lysate Dispersin B
• Lysate Pyocin S5
• Lysate non-transformed E. coli BL21

These conditions were both inoculated at 25% (163µL of component + 487µL of Dulbecco's phosphate-buffered saline) or 50% (325µL of component + 325µL of DPBS) in triplicate and compared to a non-treated condition.

Furthermore, we wanted to evaluate if the Pyocin S5 was able to kill planktonic Pseudomonas aeruginosa. For this experiment, we used four different growing cultures:

• BL21 wt 20mL (control -)
• BL21 PyoS5 20mL
• BL21 PyoS5 10mL
• BL21 PyoS5 5mL

After reaching 0.9 OD, the sonication protocol was executed to prepare four protein samples of 500µL.
In addition, two negative control samples of 500µL were also prepared:

• Buffer
• TSP (culture medium)

From this step, six growing cultures (3,5mL) of P. aeruginosa were set up at 0.1 OD and all of these previous samples were added inside.
Indeed, 450µL of each protein and control samples were used to evaluate if the Pyocin S5 was able to kill P. aeruginosa by monitoring the OD overtime at 37°C (2H).

Figure 14: Protocols experiments used to determine the killing effect of the Pyocin S5 on planktonic pseudomonas aeruginosa.

In addition, another experiment on an agar plate was performed to complement the previous one. Using the disk diffusion test, we wanted to show if the Pyocin S5 was able to block the growth of P. aeruginosa on agar plates. Firstly, we spread 100µL of P. aeruginosa on an agar plate and we deposited 50µL of each protein and control samples in six different discs. Then, these six discs were put on the plate and this one was incubated at 37°C overnight.

Figure 15: Schema representing the experiment on an agar plate to measure the killing effect of five different samples on pseudomonas aeruginosa.

GO TO RESULTS

GO TO DESIGN

Delivery system

In order to permit PyoBusters to control its population and release therapeutic molecules it is necessary to modulate the transcription of the lysis proteins (E7), but according to the design of our system, it was not possible to change the promoter. The unique option was to modulate the transcription of the colicin protein through the selection of 5’UTR sequences using UTR designer.

1. 5’UTRs comparaison

It was important to validate the power value of the transcription given by the software. To do so, initially, we used lsrA promoter and two different 5’UTR fused to the mCherry reporter gene. First, we built pUCBB-mCherry plasmid combining the igem part BBa_J06504 containing mCherry and the pUCBB backbone from pUCBB-eGFP. The next step was the integration into the plasmid pUCBB-mCherry of the promoter PlsrA with the respective 5’UTR. The first 5’UTR has the highest transcriptional rate (5’UTR mCherry_High = 600 thousand) and the second one has a lower transcriptional rate, 50% less powerful than the high one. We used the igem part Bba_K649100 as promoter lsrA. PlsrA was cloned in the pUCBB-mCherry plasmid and we obtained both pUCBB-Plsr_High-mCherry and pUCBB-Plsr_Low-mCherry .

Figure 16 representing the part BBa_K3463023.

Figure 17 representing the part BBa_K3463024.

After obtaining the two plasmids that express mCherry at different rates, we needed a mCherry constitutive expression to compare it to the PlsrA expression and demonstrate that it is related to the density of the bacterial population. For this purpose, we designed pUCBB-J23100-mCherry.

E. coli DH5 alpha strain doesn't produce AI-2 that is why the previous construction was used to transform E. coli BL21, a strain which produces AI-2 therefore allowing the expression of the reporter gene.

BL21 with the plasmid of interest, were grown overnight and were used to inoculate a culture at OD = 0.5 to follow the mCherry expression hourly.

2. E. coli lysis

The challenge of the delivery system we designed is to induce bacterial lysis according to the growth which is monitored thanks to the optical density. In order to test different 5’UTR as we did for modulating the expression of mCherry, we selected three 5’UTR and we named them 100%, 50%, and 25% as the percentage of the power value of the E7 transcription. Notice that 100% is equivalent to 2 million values.
First, we cloned each PlsrA fused to the 5’UTR sequence in pUCBB-eGFP, then we inserted the E7 gene Bba_K117000. We obtained pUCBB-Plsr_100%-E7 BBa_K3463025, pUCBB-Plsr_50%-E7 BBa_K3463026 and pUCBB-Plsr_25%-E7 BBa_K3463027.

Figure 18 representing the part BBa_K3463025.

Once we obtained the 3 constructs, we followed hourly the OD to evaluate the lysis in the same conditions as we did previously.
It is admitted that this is not the best method to evaluate the lysis but due to the lack of time, we were not able to perform another more quantitative method. If we could have experimented differently we would have used propidium iodide and Cyber Green labeling or we would have simply counted the colonies on plates after serial dilutions.

GO TO RESULTS

GO TO DESIGN

Summary of the sequences and the primers to amplify iGEM parts

5’UTR name												Sequences
PlsrHigh-mCherry												5'ATTGTGATCTATTCGTCGGAAATATGTGCAATGTCCACCTAAGGTTATGAACAAATTA AAAGCAGAAATACATTTGTTCAAAACTCACCTGCAAAACCGTCGAAAACGTGAGGGG GTTGTCAT 3'
PlsrLow-mCherry												5'ATTGTGATCTATTCGTCGGAAATATGTGCAATGTCCACCTAAGGTTATGAACAAATTA AAAGCAGAAATACATTTGTTCAAAACTCACCTGCAAAACCGTCGCGAACGTGAGGG GGTTGTCAT 3'
Plsr100%-E7												5'ATTGTGATCTATTCGTCGGAAATATGTGCAATGTCCACCTAAGGTTATGAACAAATTA AAAGCAGAAATACATTTGTTCAAAACTCACCTGCAAAACAAAAAAACACAAAGGAGC ATCACAT 3'
Plsr50%-E7												5'ATTGTGATCTATTCGTCGGAAATATGTGCAATGTCCACCTAAGGTTATGAACAAATTA AAAGCAGAAATACATTTGTTCAAAACTCACCTGCAAAACTAAACCCATCAAAGGAGCA TCACAT 3'
Plsr25%-E7												5'ATTGTGATCTATTCGTCGGAAATATGTGCAATGTCCACCTAAGGTTATGAACAAATTA AAAGCAGAAATACATTTGTTCAAAACTCACCTGCAAAACTAAGCTCATCAAAGGAGCA TCACAT 3'
J23100												5’GTCTCTAGAATGCAATGAGGCCATTTAAGGCCATTACGCGATTAGCCTTGACGGCT AGCTCAGTCCTAGGTACAGTGCTAGCGAAATGGGGTTGGGAGGTAGAACATATGTAG 3’

gene	FRW	REV
Delivery system
mCherry	5'CCACATATGGTGAGCAAGGGCGA 3'	5'AATATGCATTTATTACTTGTAC AGCTCGTCCATGC 3'
E7	5'ATCCATATGAAAAAAATAACAGGGAT 3'	5'ATGCATTTACTGCGTTTCCACTC 3'
Plsr with mCherry UTR	5'CTAGAATTCTAGGATCCATCTAGAATT GTGATCTATTCGTCGG 3'	5'CTACATATGACAACCCCCTCAC 3'
Therapeutic system
Dispersin B	5'GTACATATGTTATTAATGATGA TGGTGGTG 3'	5'CGAATGCATACAACCCCCTCAC 3'
Alginate lyase	5'GATCATATGCGAATCAGCATCTTT 3'	5'AGAATGCATCTACCAGCAGATGCCCT 3'
Pyocin S5	5'TTGCATATGTCCAATGACAACGAAG 3'	5'CGAATGCATTTAAATGGATATT ACAAGATTGTTTG 3'

Experiments

PyoBusters’ goal is to destroy the biofilm of P. aeruginosa which acts in different environments. As engineers we wanted to provide the experimenters a way to grow their biofilms and insert the modified E. coli in an automated experience. Hence we built an incubator called the Automated Measurement Incubator (AMI) which is built and implemented in 4 parts:

• The environment module that controls and monitor the atmosphere inside the box.
• The agitation module that operates the plate movements.
• The fluorescent module that makes the analysis during the whole experiment.
• The software that controls the 3 previous modules and allows a Human Computer Interface.

DryLab Introduction

Concerning the Dry Lab, experiments are done all along the building phase. Unlike the manipulation of bacteria, modifying parameters or code is fast, and testing the consequence of those modifications is also very fast. This is why it is unlikely to index every little run tests that are done, as many of them only concerns very little modifications.

GO TO RESULTS

GO TO DESIGN

Team Grenoble_Alpes

Contact

• Igem grenoble
  Place du Commandant Nal
  38700, La Tronche, France

• igem.grenoble.2020@gmail.com

This wiki was completely designed and coded by the team members of the 2020 Grenoble_Alpes' Team, all content on this wiki is available under the Creative Commons Attribution 4.0 license (or any later version).