Difference between revisions of "Team:Calgary/Thymol Engineering"

Line 375: Line 375:
  
 
<p>We will run the PCR products on a 1% gel electrophoresis. The virtual gel below shows the expected results of the gel.</p>
 
<p>We will run the PCR products on a 1% gel electrophoresis. The virtual gel below shows the expected results of the gel.</p>
 +
 +
<center><img class="img-fluid"style="width:40%; font-color:grey;"src="https://static.igem.org/mediawiki/2020/6/60/T--Calgary--Thymolcpcr.jpeg" /></center>
 +
<br>
 +
<p style="font-size: 85%; color: grey;">Figure 6. Virtual gel showing the results of a <span style="font-style: italic;class="italic">Yarrowia lipolytica</span> cPCR upon transformation with the thymol gene cassettes. The first lane contains ddH2O. The second lane contains an empty PSB1A3 vector (expected band size = 2155bp).The stand-alone strain contains TvTPS1 + CYP71D178 + Nourseothricin resistance (expected band size= 4155p), and strain 3 contains  TvTPS1 + CYP71D178 +NpBGS + Nourseothricin resistance (expected band size= 8117bp). </p>
  
  

Revision as of 01:58, 28 October 2020



OVERVIEW




Optimizing Nutrient Absorption Through Anthelmintics

To allow our target communities to maximize micronutrient and vitamin A absorption in between deworming seasons, we will engineer our yeast to produce thymol which is naturally found in thyme leaves. This will allow our yeast consumers to alleviate damage and destroy parasitic worms in the intestines. Our initial goal is to create a proof of concept in the lab. To do this, we followed the engineering design cycle to build our project:



  1. Understand the Problem

  2. Research and Ideate Solutions: Identifying Thymol

  3. Design Solutions: Part design

  4. Design Solutions: Experimental design

  5. Create and Test: Thymol Testing

  6. Evaluate

Over the next year, we will be working towards a lab proof of concept for thymol testing and production. This engineering design cycle will repeat once we have accomplished this and look towards community implementation. For more information on our plans for next year and beyond iGEM, please refer to the Future Directions section.

Figure 1. Intestinal parasites (left) and the molecular structure of thymol (right).


UNDERSTANDING THE PROBLEM

Inadequate Access to Healthcare

Mass-supplementation of Vitamin A to deficient regions have been ongoing for decades.However, even with biannual vitamin A supplementation for children and biofortified crops such as golden rice, intestinal parasites still play the villain in preventing the vitamin’s assimilation by perforating the intestines. Organizations such as the UN, WHO, and the Bill Gates Foundation couple biannual vitamin supplementation with deworming using agents like albendazole and mebendazole, but lack of clean water and proper footwear allow these parasites to return and thrive in the intestines.

Parasitic worms are among the most widespread human infections to date, affecting 2 billion people worldwide. The most common of these are Ascaris lumbricoides or the giant roundworm, hookworms, and Trichuris trichiura or the human whipworm. These worms may be obtained from direct contact with the soil, or through improper measures in hygiene. These worms cause a variety of symptoms such as stunted growth, decreased metabolic rates, physical and mental fatigue, and malnutrition (Kumar, Jain, & Jain, 2014). Since these parasites perforate the intestines, nutrition absorption is severely inhibited, causing several micronutrient supplementation programs to falter.

Albendazole has been used as an effective cure for intestinal worm infections. When treating roundworms it has a cure rate of 98.9% and egg reduction rates of 99.6%. For hookworms, it is 56.8% and 97.7% respectively, while in whipworms it is 10.% and 73.3%. However, even with these highly effective drugs the worms return and thrive until the next round of deworming because of poor hygiene due to lack of access to clean water and proper footwear.

Talking to Dr. John Gilleard and Dr. Paul E. Mains from the University of Calgary, we found out that these drugs were first intended for animals but were later implemented in humans. They believe that intestinal parasites will sooner or later develop drug resistances just as they have discovered in sheep and cattle models, which is why development of new treatments should be kept on the radar.



IDENTIFYING THYMOL

Why produce an anthelmintic?

For this part of the project, we initially intended to produce omega-3 fatty acids such as eicosapentaenoic acid (EPA) which has cognitive benefits to improve the nutritional value of our yeast. We learned from Dr. Dia Sanou and Lourlin Ugdiman, two public health experts who have worked in Africa and the Philippines, that producing a safe and supplementary anthelmintic as a temporary measure is a better use of our efforts. That temporary measure would be sufficient until the next round of deworming.

Our team started looking for plant-based compounds with promising effects for anthelmintics against nematodes. We came across thymol, a compound which is the primary component in thyme oil. Thymol has been used with epsom salts to cure hookworm infections in rural schoolchildren as early as 1912. Half a gram would be administered to children ages 1-5 and a gram for those aged 5-10 (Rural School and Hookworm Disease p. 12, 1970). In modern times, the compound can be found in products such as soaps, disinfectants to pesticides, and in anti-inflammatories. It is labeled to be safe for ingestion with “negligible toxicity” by the USFDA in humans. However, in high doses it may cause burning pain in the oesophagus, nausea, abdominal pain, vomiting, and dizziness [CITE DATASHEET].

Thymol has been found to be generally safe for consumption in diluted forms. In regards to human consumption, thymol persists in the blood plasma for an average of 38 hours, with its half-life being 10.2 hours. Since the compound is lipophilic, it is absorbed quickly in the upper gut within 20 minutes of ingestion (Kohlert et al. 2002) . This works in conjunction with our yeast which is oleaginous in nature. In an oral toxicity study, the LD50 of thymol in rats was 980mg/kg which is much higher compared to other products such as caffeine of vitamin D which have 200mg/kg and 10mg/kg of LD50 respectively. Another study found no adverse effects on gross pathology and hematology when mice were supplemented with 300mg/kg per day of thymol in their diet for 19 weeks (Xie et al. 2019). These studies are important because drug trials always start in rat and mice models before moving to human trials. Further, they provide crucial information to consider in our part design.


PART DESIGN

Thymol has been previously expressed in microbial systems such as S. cerevisiae (Aly and Abo-Sereih 2020). Since thymol is a simple monoterpenoid, its expression in Yarrowia lipolytica would not be too complex. This is because the organism is capable of producing geranyl diphosphate through the non-mevalonate (MEP) pathway, and would only need two additional genes to produce thymol. These genes are the TvTPS1 terpene synthase gene and the CYP71D178 cytochrome P450 gene from Thymus vulgaris, better known as thyme.

Gauging Thymol Production Levels

Since Dr. Gupta advised us to observe more precaution with regards to the safety and efficacy of thymol, we will be expressing the compound under the control of two different promoters. Our first promoter is the Translation Elongation Factor 1 (TEF1) promoter which is a well-known strong constitutive promoter in Y. lipolytica (Hong et al. 2012). Our second promoter is the Proline Dehydrogenase 2 (POX2) promoter which is known to be a relatively weaker promoter in Y. lipolytica (Shabir Hussain et al. 2017). In the future when we express thymol in our chassis, we will quantify its production and determine which is better suited to our end users’ safety.

Our construct design will follow that of cellulase engineering and will be assembled through Gibson assembly, except without a signal peptide. This is because we do not need to secrete thymol as it is meant to be consumed as part of the yeast. For a more detailed description of our construct design, please click here.

For our proof-of-concept, we will be cloning and expressing this construct containing both TvTPS1 and CYP71D178 without any cellulases in Y. lipolytica. Once we have proven its functionality, we will then include these genes to our third Y. lipolytica strain containing the NpBGS beta-glucosidase using Gibson Assembly.


EXPERIMENTAL DESIGN

Thoughtful design of experiments

Below are detailed descriptions of the planned steps/experiments we will conduct to integrate the cellulase enzymes into the Y. lipolytica genome. Our first experiments will be carried out in Escherichia coli DH5α for cloning and Gibson Assembly, after which the gene cassettes will be introduced to Y. lipolytica. The experimental workflow will follow the depiction in figure 5.

Figure 5. Experimental workflow of thymol production into Y. lipolytica.

To express thymol in Yarrowia lipolytica a terpene synthase (TvTPS1) and a cytochrome P450 (CYP71D178) will be introduced. To keep substantial DNA stocks we will first transform our constructs in pSB1A3 into chemically competent Escherichia coli DH5α. This DNA would then be extracted through plasmid miniprep. Since Y. lipolytica functions best with non-homologous end joining, we will linearize the plasmid from E. coli with (insert restriction enzyme here) then transform it into Y. lipolytica using lithium acetate transformation which will result in random integration into its genome.

Table 1. Table 1. Each part listed in the first column must be individually digested by the corresponding enzyme(s) listed in the second column (i.e BBa_K3629016 is digested with BbsI and SalI). The digested parts can then be placed in the same reaction tube with the Gibson reagents added for the plasmid in column three to form. These plasmids are classified as plasmids made in a single Gibson reaction as the initial digested parts are put in the same reaction tube.

Parts to add (DNA Part names)

Digest parts with1

Resulting plasmid (composition)

Stand-alone Strain

  1. TvTPS1 construct
  2. CYP71D178 construct
  3. BBa_K3629015 (nourseothricin construct)

1.    SmaI and BbsI

2.    SalI and SmaI

3.    SmaI

TvTPS1 + CYP71D178 +Nourseothricin2

Strain 3

  1. BBa_K3629018 (NpBGS construct)
  2. TvTPS1 construct
  3. CYP71D178 construct
  4. BBa_K3629015 (nourseothricin construct)

1.    NcoI and SalI

2.    SmaI and BbsI

3.    SalI and SmaI

4.    SmaI

NpBGS + TvTPS1 + CYP71D178+ Nourseothricin

The resulting Gibson Assembled plasmids will be transformed into E. coli for propagation and plasmid amplification. Following extraction, the plasmids will then be linearized with NotI, gel purified, and each will be transformed into a Y. lipolytica competent cell aliquot using the lithium acetate method to create the three strains. If these gene cassettes are unable to be made after several attempts and troubleshooting to change the DNA concentrations/reaction conditions, then these cassettes can be assembled in many different ways, including sequentially. It is important to note that the TvTPS1 and CYP71D178 constructs are not submitted this year, but will be for iGEM 2021. Check out the appendix page and the part collection page to learn more or see the different kinds of plasmids that can be produced with our collection.

We were very fortunate to be given protocols for transformation of DNA into Y. lipolytica by Dr. Rodrigo Ledesma-Amaro. As per this protocol, cells will be made chemically competent using lithium acetate and transformed with the linearized gene cassettes containing nourseothricin as a selection marker. If the transformation is successful, we expect colonies to develop when plated on YPD with nourseothricin. If this method does not work upon changing the concentration of DNA or incubation periods, other protocols using electroporation may give higher success rates.

Colonies that appear on the nourseothricin plate will undergo colony PCR (cPCR) to verify the integration of the insert into the genome. The parts were designed to be verified using the following primers:

Forward Primer: 5’ GCTTGCTAATGTTAAGTCTCTGC 3’

Reverse Primer: 5’ GGATTCACATCAGTCAATCACC 3’

We will run the PCR products on a 1% gel electrophoresis. The virtual gel below shows the expected results of the gel.


Figure 6. Virtual gel showing the results of a Yarrowia lipolytica cPCR upon transformation with the thymol gene cassettes. The first lane contains ddH2O. The second lane contains an empty PSB1A3 vector (expected band size = 2155bp).The stand-alone strain contains TvTPS1 + CYP71D178 + Nourseothricin resistance (expected band size= 4155p), and strain 3 contains TvTPS1 + CYP71D178 +NpBGS + Nourseothricin resistance (expected band size= 8117bp).

SDS PAGE gels provide a qualitative verification of protein production. We will use them to confirm that our terpene synthase and cytochrome P450 proteins are being expressed. Since both proteins will not be secreted, we will be testing our cell lysate only.

A 10% SDS PAGE will be run with the following expected results:

To easily quantify our protein production, we will be performing a Bradford assay.

explain GC/MS protocols here

For the worms!

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

FUTURE DIRECTIONS

What we've achieved this year

✔ Created our constructs for thymol production in Y. lipolytica
✔ Collected our reagents and C. elegans for testing
✔ Extensively planned all of our experiments and made troubleshooting plans

iGEM 2021

Below is our timeline for next year. blurb




Iterate and Optimize: Beyond iGEM

blurb here



References

Paper 1